Incidental Mutation 'R7036:Plcg2'
ID546687
Institutional Source Beutler Lab
Gene Symbol Plcg2
Ensembl Gene ENSMUSG00000034330
Gene Namephospholipase C, gamma 2
SynonymsPlcg-2, PLCgamma2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7036 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location117498291-117635142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117596306 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 700 (R700H)
Ref Sequence ENSEMBL: ENSMUSP00000079991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081232]
PDB Structure Crystal structure of the N-terminal SH2 domain of mouse phospholipase C-gamma 2 [X-RAY DIFFRACTION]
Solution structure of the SH3 domain from Phospholipase C, gamma 2 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000081232
AA Change: R700H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079991
Gene: ENSMUSG00000034330
AA Change: R700H

DomainStartEndE-ValueType
PH 21 133 1.87e-4 SMART
PLCXc 312 456 2.29e-96 SMART
low complexity region 461 476 N/A INTRINSIC
PDB:2K2J|A 478 516 6e-17 PDB
SH2 530 623 2.24e-30 SMART
SH2 644 726 1.16e-28 SMART
SH3 772 828 3.12e-18 SMART
PH 789 910 4.31e0 SMART
PLCYc 930 1044 1.18e-66 SMART
C2 1062 1167 1.41e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for some null alleles show decreased B cell and impaired NK cell function. Other homozygous null alleles show aberrant separation of blood and lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Ahnak2 A G 12: 112,778,781 probably benign Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Ank2 T C 3: 126,946,392 probably benign Het
Ank3 C T 10: 69,999,379 T680M probably damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Arl8a G C 1: 135,154,468 E145Q probably benign Het
Armc8 C T 9: 99,483,965 probably null Het
Arsj T C 3: 126,365,000 L76P probably damaging Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Bcl6 A T 16: 23,974,861 L112Q probably damaging Het
Bfsp1 T A 2: 143,826,923 T579S possibly damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Cd2ap A T 17: 42,798,599 L623Q probably damaging Het
Cerkl T C 2: 79,341,378 I379V probably benign Het
Cndp2 T A 18: 84,669,945 H307L possibly damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dixdc1 T A 9: 50,682,564 R254S probably benign Het
Dopey2 T A 16: 93,777,490 D30E probably benign Het
Duox2 T G 2: 122,280,453 H1513P probably damaging Het
Dyrk1a G A 16: 94,686,568 V546I probably benign Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Emc8 A T 8: 120,659,051 V108E probably benign Het
Epb41l1 A G 2: 156,529,402 T720A probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam71b G A 11: 46,407,408 S513N Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Fem1b T A 9: 62,797,028 I317F probably damaging Het
Focad A G 4: 88,124,637 E36G probably benign Het
Fryl C T 5: 73,055,608 E2275K probably benign Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gatad2a A T 8: 69,917,994 N114K probably damaging Het
Gcnt2 CTAATG C 13: 40,887,556 probably null Het
Gm884 T A 11: 103,615,812 probably benign Het
Gramd1a A G 7: 31,132,756 probably null Het
Gsn T A 2: 35,292,599 W187R probably damaging Het
Hoxc12 G A 15: 102,938,360 G229D probably damaging Het
Ints14 T C 9: 64,964,545 V55A probably benign Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Klf1 C T 8: 84,902,750 S68F possibly damaging Het
Kmt2e A G 5: 23,478,743 E333G probably null Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Lrp1b T C 2: 41,112,342 D2001G possibly damaging Het
Lrrc71 T C 3: 87,748,386 T27A probably benign Het
Lrrcc1 T C 3: 14,563,009 V958A possibly damaging Het
Med15 A T 16: 17,698,155 M1K probably null Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Nat10 T C 2: 103,754,108 N108S probably benign Het
Ncald A T 15: 37,368,878 S178T probably benign Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Olfr1167 T A 2: 88,149,125 D298V probably damaging Het
Olfr995 A G 2: 85,438,430 S243P probably damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Pcdhb4 T A 18: 37,308,782 C382S possibly damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Popdc2 A T 16: 38,362,811 Y52F probably damaging Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Pspc1 A C 14: 56,758,628 probably null Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rrh T C 3: 129,815,693 E55G possibly damaging Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Sds A T 5: 120,480,847 K125M possibly damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Tbx1 G T 16: 18,586,801 P38T unknown Het
Tcl1 T C 12: 105,217,601 probably benign Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdr70 T C 15: 7,884,374 D598G possibly damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Zfp872 C T 9: 22,200,560 P445L probably benign Het
Other mutations in Plcg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Plcg2 APN 8 117556071 missense possibly damaging 0.89
IGL00911:Plcg2 APN 8 117586515 missense probably benign 0.17
IGL00952:Plcg2 APN 8 117607217 missense probably benign
IGL01115:Plcg2 APN 8 117557329 missense probably damaging 1.00
IGL01326:Plcg2 APN 8 117573999 splice site probably benign
IGL01357:Plcg2 APN 8 117614161 splice site probably benign
IGL01705:Plcg2 APN 8 117581662 missense probably damaging 1.00
IGL01755:Plcg2 APN 8 117621241 missense possibly damaging 0.48
IGL01828:Plcg2 APN 8 117590233 missense probably damaging 1.00
IGL02307:Plcg2 APN 8 117579896 critical splice donor site probably null
IGL02345:Plcg2 APN 8 117585180 missense probably damaging 0.99
IGL02448:Plcg2 APN 8 117607221 missense probably benign
IGL02587:Plcg2 APN 8 117558113 missense possibly damaging 0.80
IGL02646:Plcg2 APN 8 117603883 missense possibly damaging 0.88
IGL03409:Plcg2 APN 8 117583495 missense probably damaging 0.96
Ctenophore UTSW 8 117557318 missense probably damaging 0.98
Poseidon UTSW 8 117615238 missense probably damaging 1.00
Poseidon2 UTSW 8 117577874 missense possibly damaging 0.80
queen UTSW 8 117581707 missense probably benign 0.00
Seahorse UTSW 8 117589835 splice site probably null
Teleost UTSW 8 117583549 missense probably damaging 1.00
Theseus UTSW 8 117596332 missense probably damaging 0.99
trident UTSW 8 117612978 missense probably benign 0.00
R0172:Plcg2 UTSW 8 117579782 missense probably benign 0.00
R0194:Plcg2 UTSW 8 117573397 splice site probably benign
R0410:Plcg2 UTSW 8 117615373 missense probably damaging 0.98
R0462:Plcg2 UTSW 8 117585305 missense probably benign 0.06
R0494:Plcg2 UTSW 8 117556104 missense probably damaging 1.00
R0522:Plcg2 UTSW 8 117614288 splice site probably null
R0612:Plcg2 UTSW 8 117573365 missense probably benign 0.01
R1239:Plcg2 UTSW 8 117556044 missense probably benign
R1367:Plcg2 UTSW 8 117615238 missense probably damaging 1.00
R1608:Plcg2 UTSW 8 117614235 missense possibly damaging 0.89
R1756:Plcg2 UTSW 8 117592708 missense probably benign 0.02
R2176:Plcg2 UTSW 8 117612994 missense probably damaging 1.00
R3500:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4043:Plcg2 UTSW 8 117612978 missense probably benign 0.00
R4654:Plcg2 UTSW 8 117504315 missense probably benign
R4883:Plcg2 UTSW 8 117607133 nonsense probably null
R4932:Plcg2 UTSW 8 117607083 missense probably benign 0.05
R5080:Plcg2 UTSW 8 117590003 missense probably benign 0.10
R5226:Plcg2 UTSW 8 117577874 missense possibly damaging 0.80
R5264:Plcg2 UTSW 8 117634793 missense possibly damaging 0.95
R5298:Plcg2 UTSW 8 117605249 missense probably benign
R5473:Plcg2 UTSW 8 117634401 missense probably benign
R5555:Plcg2 UTSW 8 117612995 nonsense probably null
R5557:Plcg2 UTSW 8 117586557 missense probably damaging 0.99
R5805:Plcg2 UTSW 8 117598495 critical splice donor site probably null
R5826:Plcg2 UTSW 8 117610844 missense probably benign 0.19
R5871:Plcg2 UTSW 8 117504217 missense probably damaging 1.00
R5894:Plcg2 UTSW 8 117504349 missense probably damaging 0.99
R6142:Plcg2 UTSW 8 117585271 missense probably benign
R6609:Plcg2 UTSW 8 117568170 missense probably benign 0.31
R6684:Plcg2 UTSW 8 117596332 missense probably damaging 0.99
R6710:Plcg2 UTSW 8 117557347 missense probably benign 0.05
R6931:Plcg2 UTSW 8 117557319 missense probably benign 0.24
R6946:Plcg2 UTSW 8 117504190 missense probably benign
R7070:Plcg2 UTSW 8 117596306 missense probably benign
R7072:Plcg2 UTSW 8 117589835 splice site probably null
R7214:Plcg2 UTSW 8 117583549 missense probably damaging 1.00
R7351:Plcg2 UTSW 8 117590310 missense possibly damaging 0.95
R7393:Plcg2 UTSW 8 117579825 missense possibly damaging 0.90
R7443:Plcg2 UTSW 8 117504289 missense probably benign 0.00
R7513:Plcg2 UTSW 8 117579853 missense probably damaging 0.99
R7609:Plcg2 UTSW 8 117558113 missense probably benign 0.01
R8134:Plcg2 UTSW 8 117557318 missense probably damaging 0.98
R8399:Plcg2 UTSW 8 117596362 missense probably damaging 1.00
R8701:Plcg2 UTSW 8 117581677 missense probably damaging 1.00
R8774:Plcg2 UTSW 8 117579846 missense possibly damaging 0.79
R8774-TAIL:Plcg2 UTSW 8 117579846 missense possibly damaging 0.79
RF008:Plcg2 UTSW 8 117573524 splice site probably null
X0027:Plcg2 UTSW 8 117555983 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCTGGGTGTTGAGCATCAC -3'
(R):5'- ATGACTAACAAGCCCAAGGG -3'

Sequencing Primer
(F):5'- TGAAAAGACCCCAGTGTCTCGTG -3'
(R):5'- GGGCGTCAACCTACCATATTATATCG -3'
Posted On2019-05-13