Incidental Mutation 'R7036:Fem1b'
ID546691
Institutional Source Beutler Lab
Gene Symbol Fem1b
Ensembl Gene ENSMUSG00000032244
Gene Namefeminization 1 homolog b (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.468) question?
Stock #R7036 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location62791821-62811934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62797028 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 317 (I317F)
Ref Sequence ENSEMBL: ENSMUSP00000034775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034775]
Predicted Effect probably damaging
Transcript: ENSMUST00000034775
AA Change: I317F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034775
Gene: ENSMUSG00000032244
AA Change: I317F

DomainStartEndE-ValueType
ANK 45 74 6.81e-3 SMART
ANK 87 116 6.65e-6 SMART
ANK 120 149 8.39e-3 SMART
ANK 153 182 8.91e-7 SMART
ANK 186 215 4.13e-2 SMART
ANK 218 246 6.71e-2 SMART
ANK 483 527 1.72e1 SMART
ANK 531 570 6.05e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ankyrin repeat protein that belongs to the death receptor-associated family of proteins and plays a role in mediating apoptosis. The encoded protein is also thought to function in the replication stress-induced checkpoint signaling pathway via interaction with checkpoint kinase 1. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous targeted mutants display abnormal glucose tolerance due to defective glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Ahnak2 A G 12: 112,778,781 probably benign Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Ank2 T C 3: 126,946,392 probably benign Het
Ank3 C T 10: 69,999,379 T680M probably damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Arl8a G C 1: 135,154,468 E145Q probably benign Het
Armc8 C T 9: 99,483,965 probably null Het
Arsj T C 3: 126,365,000 L76P probably damaging Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Bcl6 A T 16: 23,974,861 L112Q probably damaging Het
Bfsp1 T A 2: 143,826,923 T579S possibly damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Cd2ap A T 17: 42,798,599 L623Q probably damaging Het
Cerkl T C 2: 79,341,378 I379V probably benign Het
Cndp2 T A 18: 84,669,945 H307L possibly damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dixdc1 T A 9: 50,682,564 R254S probably benign Het
Dopey2 T A 16: 93,777,490 D30E probably benign Het
Duox2 T G 2: 122,280,453 H1513P probably damaging Het
Dyrk1a G A 16: 94,686,568 V546I probably benign Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Emc8 A T 8: 120,659,051 V108E probably benign Het
Epb41l1 A G 2: 156,529,402 T720A probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam71b G A 11: 46,407,408 S513N Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Focad A G 4: 88,124,637 E36G probably benign Het
Fryl C T 5: 73,055,608 E2275K probably benign Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gatad2a A T 8: 69,917,994 N114K probably damaging Het
Gcnt2 CTAATG C 13: 40,887,556 probably null Het
Gm884 T A 11: 103,615,812 probably benign Het
Gramd1a A G 7: 31,132,756 probably null Het
Gsn T A 2: 35,292,599 W187R probably damaging Het
Hoxc12 G A 15: 102,938,360 G229D probably damaging Het
Ints14 T C 9: 64,964,545 V55A probably benign Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Klf1 C T 8: 84,902,750 S68F possibly damaging Het
Kmt2e A G 5: 23,478,743 E333G probably null Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Lrp1b T C 2: 41,112,342 D2001G possibly damaging Het
Lrrc71 T C 3: 87,748,386 T27A probably benign Het
Lrrcc1 T C 3: 14,563,009 V958A possibly damaging Het
Med15 A T 16: 17,698,155 M1K probably null Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Nat10 T C 2: 103,754,108 N108S probably benign Het
Ncald A T 15: 37,368,878 S178T probably benign Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Olfr1167 T A 2: 88,149,125 D298V probably damaging Het
Olfr995 A G 2: 85,438,430 S243P probably damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Pcdhb4 T A 18: 37,308,782 C382S possibly damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Plcg2 G A 8: 117,596,306 R700H probably benign Het
Popdc2 A T 16: 38,362,811 Y52F probably damaging Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Pspc1 A C 14: 56,758,628 probably null Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rrh T C 3: 129,815,693 E55G possibly damaging Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Sds A T 5: 120,480,847 K125M possibly damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Tbx1 G T 16: 18,586,801 P38T unknown Het
Tcl1 T C 12: 105,217,601 probably benign Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdr70 T C 15: 7,884,374 D598G possibly damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Zfp872 C T 9: 22,200,560 P445L probably benign Het
Other mutations in Fem1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Fem1b APN 9 62796919 missense probably damaging 1.00
IGL01306:Fem1b APN 9 62797528 missense possibly damaging 0.69
IGL02059:Fem1b APN 9 62796164 missense possibly damaging 0.57
IGL02292:Fem1b APN 9 62796695 missense probably benign 0.00
IGL03390:Fem1b APN 9 62796964 missense probably benign 0.01
ANU23:Fem1b UTSW 9 62797528 missense possibly damaging 0.69
R0054:Fem1b UTSW 9 62796800 missense probably damaging 1.00
R0054:Fem1b UTSW 9 62796800 missense probably damaging 1.00
R0733:Fem1b UTSW 9 62796843 missense possibly damaging 0.50
R1661:Fem1b UTSW 9 62797274 missense probably damaging 0.96
R1697:Fem1b UTSW 9 62797174 missense possibly damaging 0.56
R2228:Fem1b UTSW 9 62796738 nonsense probably null
R2326:Fem1b UTSW 9 62797003 missense probably damaging 0.98
R3123:Fem1b UTSW 9 62796554 missense probably benign 0.00
R3124:Fem1b UTSW 9 62796554 missense probably benign 0.00
R3125:Fem1b UTSW 9 62796554 missense probably benign 0.00
R4849:Fem1b UTSW 9 62797294 missense probably damaging 1.00
R5749:Fem1b UTSW 9 62797006 missense probably damaging 1.00
R6338:Fem1b UTSW 9 62797011 missense probably benign 0.08
R6727:Fem1b UTSW 9 62796733 missense possibly damaging 0.65
R7287:Fem1b UTSW 9 62796122 missense probably benign 0.00
R7538:Fem1b UTSW 9 62811167 missense probably damaging 0.98
R7877:Fem1b UTSW 9 62796562 missense probably benign 0.13
R7960:Fem1b UTSW 9 62796562 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGAGCAAACCGAAGCAGATC -3'
(R):5'- GTGCCTCCTTTGCAAATGATCG -3'

Sequencing Primer
(F):5'- CAAACCGAAGCAGATCTTTGTG -3'
(R):5'- TCGTGAGAACTATGACATCATGAAG -3'
Posted On2019-05-13