Incidental Mutation 'R7036:Pspc1'
ID546715
Institutional Source Beutler Lab
Gene Symbol Pspc1
Ensembl Gene ENSMUSG00000021938
Gene Nameparaspeckle protein 1
Synonyms5730470C09Rik, PSP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7036 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location56720710-56778316 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 56758628 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022507] [ENSMUST00000163924]
Predicted Effect probably null
Transcript: ENSMUST00000022507
SMART Domains Protein: ENSMUSP00000022507
Gene: ENSMUSG00000021938

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
RRM 82 149 8.91e-21 SMART
RRM 156 232 1.51e-9 SMART
low complexity region 298 310 N/A INTRINSIC
low complexity region 320 344 N/A INTRINSIC
low complexity region 350 376 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 433 452 N/A INTRINSIC
low complexity region 494 516 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163924
SMART Domains Protein: ENSMUSP00000133038
Gene: ENSMUSG00000021938

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
RRM 82 149 8.91e-21 SMART
RRM 156 232 1.51e-9 SMART
low complexity region 298 310 N/A INTRINSIC
low complexity region 320 344 N/A INTRINSIC
low complexity region 350 376 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 433 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168575
SMART Domains Protein: ENSMUSP00000125780
Gene: ENSMUSG00000021938

DomainStartEndE-ValueType
RRM 5 56 2.12e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein that localizes to punctate subnuclear structures that occur close to splicing speckles, known as paraspeckles. These paraspeckles are composed of RNA-protein structures that include a non-coding RNA, NEAT1/Men epsilon/beta, and the Drosophila Behavior Human Splicing family of proteins, which include the product of this gene and the P54NRB/NONO and PSF/SFPQ proteins. Paraspeckles may function in the control of gene expression via an RNA nuclear retention mechanism. The protein encoded by this gene is found in paraspeckles in transcriptionally active cells, but it localizes to unique cap structures at the nucleolar periphery when RNA polymerase II transcription is inhibited, or during telophase. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene, which is also located on chromosome 13, has been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele do not display any gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Ahnak2 A G 12: 112,778,781 probably benign Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Ank2 T C 3: 126,946,392 probably benign Het
Ank3 C T 10: 69,999,379 T680M probably damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Arl8a G C 1: 135,154,468 E145Q probably benign Het
Armc8 C T 9: 99,483,965 probably null Het
Arsj T C 3: 126,365,000 L76P probably damaging Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Bcl6 A T 16: 23,974,861 L112Q probably damaging Het
Bfsp1 T A 2: 143,826,923 T579S possibly damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Cd2ap A T 17: 42,798,599 L623Q probably damaging Het
Cerkl T C 2: 79,341,378 I379V probably benign Het
Cndp2 T A 18: 84,669,945 H307L possibly damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dixdc1 T A 9: 50,682,564 R254S probably benign Het
Dopey2 T A 16: 93,777,490 D30E probably benign Het
Duox2 T G 2: 122,280,453 H1513P probably damaging Het
Dyrk1a G A 16: 94,686,568 V546I probably benign Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Emc8 A T 8: 120,659,051 V108E probably benign Het
Epb41l1 A G 2: 156,529,402 T720A probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam71b G A 11: 46,407,408 S513N Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Fem1b T A 9: 62,797,028 I317F probably damaging Het
Focad A G 4: 88,124,637 E36G probably benign Het
Fryl C T 5: 73,055,608 E2275K probably benign Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gatad2a A T 8: 69,917,994 N114K probably damaging Het
Gcnt2 CTAATG C 13: 40,887,556 probably null Het
Gm884 T A 11: 103,615,812 probably benign Het
Gramd1a A G 7: 31,132,756 probably null Het
Gsn T A 2: 35,292,599 W187R probably damaging Het
Hoxc12 G A 15: 102,938,360 G229D probably damaging Het
Ints14 T C 9: 64,964,545 V55A probably benign Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Klf1 C T 8: 84,902,750 S68F possibly damaging Het
Kmt2e A G 5: 23,478,743 E333G probably null Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Lrp1b T C 2: 41,112,342 D2001G possibly damaging Het
Lrrc71 T C 3: 87,748,386 T27A probably benign Het
Lrrcc1 T C 3: 14,563,009 V958A possibly damaging Het
Med15 A T 16: 17,698,155 M1K probably null Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Nat10 T C 2: 103,754,108 N108S probably benign Het
Ncald A T 15: 37,368,878 S178T probably benign Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Olfr1167 T A 2: 88,149,125 D298V probably damaging Het
Olfr995 A G 2: 85,438,430 S243P probably damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Pcdhb4 T A 18: 37,308,782 C382S possibly damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Plcg2 G A 8: 117,596,306 R700H probably benign Het
Popdc2 A T 16: 38,362,811 Y52F probably damaging Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rrh T C 3: 129,815,693 E55G possibly damaging Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Sds A T 5: 120,480,847 K125M possibly damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Tbx1 G T 16: 18,586,801 P38T unknown Het
Tcl1 T C 12: 105,217,601 probably benign Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdr70 T C 15: 7,884,374 D598G possibly damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Zfp872 C T 9: 22,200,560 P445L probably benign Het
Other mutations in Pspc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Pspc1 APN 14 56771711 missense probably damaging 1.00
IGL02281:Pspc1 APN 14 56723178 missense probably benign
IGL02954:Pspc1 APN 14 56771760 missense probably benign 0.17
IGL02989:Pspc1 APN 14 56771696 intron probably benign
R1549:Pspc1 UTSW 14 56748941 missense probably damaging 1.00
R1696:Pspc1 UTSW 14 56764243 missense probably benign 0.15
R4574:Pspc1 UTSW 14 56761947 missense possibly damaging 0.91
R4599:Pspc1 UTSW 14 56777789 critical splice donor site probably null
R5132:Pspc1 UTSW 14 56723250 missense probably benign 0.09
R5243:Pspc1 UTSW 14 56764191 missense probably damaging 1.00
R5519:Pspc1 UTSW 14 56771956 missense probably benign 0.11
R5610:Pspc1 UTSW 14 56777931 missense probably damaging 1.00
R5724:Pspc1 UTSW 14 56778072 missense probably benign 0.01
R5867:Pspc1 UTSW 14 56762041 splice site probably null
R5968:Pspc1 UTSW 14 56764236 missense probably benign 0.14
R6544:Pspc1 UTSW 14 56764203 makesense probably null
R7034:Pspc1 UTSW 14 56758628 critical splice donor site probably null
X0065:Pspc1 UTSW 14 56725415 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TGGCAAATCACGAGCATTCTTAC -3'
(R):5'- TATGTGCCAGTAATAGAGATTCCAC -3'

Sequencing Primer
(F):5'- CGAGCATTCTTACCATTGCAATTCAG -3'
(R):5'- GCCAGTAATAGAGATTCCACTTTTGG -3'
Posted On2019-05-13