Incidental Mutation 'R0611:Kcnb2'
ID 54672
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Name potassium voltage gated channel, Shab-related subfamily, member 2
Synonyms Kv2.2, 9630047L19Rik
MMRRC Submission 038800-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0611 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 15357478-15793974 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 15780664 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 512 (Y512F)
Ref Sequence ENSEMBL: ENSMUSP00000135382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
AlphaFold A6H8H5
Predicted Effect probably benign
Transcript: ENSMUST00000170146
AA Change: Y512F

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000175681
AA Change: Y512F

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: Y512F

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 119,851,479 (GRCm39) M819K possibly damaging Het
Adamtsl3 T G 7: 82,178,120 (GRCm39) C528G probably damaging Het
Akap9 A G 5: 4,004,870 (GRCm39) K148E probably benign Het
Akr1b1 A T 6: 34,286,577 (GRCm39) D225E probably benign Het
Alms1 C A 6: 85,655,653 (GRCm39) Q2931K possibly damaging Het
Ano3 T C 2: 110,715,346 (GRCm39) K31E possibly damaging Het
Cdc37 A G 9: 21,053,537 (GRCm39) I242T probably damaging Het
Celsr1 T A 15: 85,816,524 (GRCm39) K1806N possibly damaging Het
Clpb T A 7: 101,436,956 (GRCm39) I707N possibly damaging Het
Cntnap2 A T 6: 47,072,483 (GRCm39) Y1017F possibly damaging Het
Creb3l2 A T 6: 37,311,416 (GRCm39) S458T probably benign Het
Ctnnd2 C A 15: 31,009,230 (GRCm39) T1109K possibly damaging Het
Dcaf10 T A 4: 45,373,011 (GRCm39) L425Q probably damaging Het
Dlec1 A G 9: 118,941,167 (GRCm39) E239G probably benign Het
Dnah2 T C 11: 69,390,020 (GRCm39) K742E probably damaging Het
Dsp A T 13: 38,371,717 (GRCm39) R889S probably damaging Het
Dync1h1 T A 12: 110,599,222 (GRCm39) M1859K probably damaging Het
Efcab7 T A 4: 99,758,886 (GRCm39) N361K probably damaging Het
Eps8l2 T C 7: 140,935,646 (GRCm39) V139A probably damaging Het
Fads3 T G 19: 10,019,200 (GRCm39) H35Q probably damaging Het
Fam163b C A 2: 27,003,583 (GRCm39) V24F probably damaging Het
Gm14496 A T 2: 181,636,904 (GRCm39) T121S probably benign Het
Gm4799 C T 10: 82,790,563 (GRCm39) noncoding transcript Het
Gm7168 A T 17: 14,169,797 (GRCm39) D388V probably benign Het
Gmeb1 A T 4: 131,953,386 (GRCm39) L460* probably null Het
Gpc6 T G 14: 118,212,430 (GRCm39) F534V probably null Het
Hectd3 A G 4: 116,853,241 (GRCm39) D156G possibly damaging Het
Itga6 T C 2: 71,650,404 (GRCm39) I150T possibly damaging Het
Kansl1 A G 11: 104,229,012 (GRCm39) M863T probably benign Het
Klhdc2 A T 12: 69,347,053 (GRCm39) M73L probably benign Het
Ktn1 A G 14: 47,932,073 (GRCm39) T667A probably benign Het
Lgsn A C 1: 31,242,736 (GRCm39) I273L probably benign Het
Lilra5 A G 7: 4,245,232 (GRCm39) D292G probably benign Het
Mrps27 C T 13: 99,541,582 (GRCm39) R229C probably damaging Het
Muc5b T G 7: 141,416,173 (GRCm39) S3040A probably benign Het
Nat14 T C 7: 4,926,275 (GRCm39) S7P probably damaging Het
Nfia A G 4: 97,671,694 (GRCm39) I135V possibly damaging Het
Nkd1 G A 8: 89,248,944 (GRCm39) A30T probably damaging Het
Nup205 A G 6: 35,202,903 (GRCm39) D1370G probably null Het
Or1j15 C G 2: 36,459,568 (GRCm39) probably null Het
Or4k15c G A 14: 50,321,310 (GRCm39) T276I probably damaging Het
Or51k2 T C 7: 103,596,400 (GRCm39) L209P probably damaging Het
Or5p79 T A 7: 108,221,494 (GRCm39) N158K possibly damaging Het
Or8s10 T C 15: 98,336,168 (GRCm39) S273P possibly damaging Het
Orc1 C T 4: 108,459,229 (GRCm39) A466V probably benign Het
Otud7a T A 7: 63,385,638 (GRCm39) D367E possibly damaging Het
Pcdhb4 A G 18: 37,441,263 (GRCm39) Y191C probably damaging Het
Pclo T C 5: 14,762,828 (GRCm39) V3767A unknown Het
Pclo T C 5: 14,728,789 (GRCm39) probably benign Het
Prmt1 A T 7: 44,628,225 (GRCm39) probably null Het
Ralgapa1 A G 12: 55,842,483 (GRCm39) F62S probably damaging Het
Rangrf T C 11: 68,863,518 (GRCm39) S163G probably benign Het
Rgs12 C A 5: 35,176,804 (GRCm39) A65E probably damaging Het
Rrbp1 T C 2: 143,830,436 (GRCm39) N577S probably damaging Het
Septin11 A G 5: 93,315,393 (GRCm39) H374R probably damaging Het
Serpina5 T G 12: 104,070,046 (GRCm39) N314K probably benign Het
Sgce T C 6: 4,689,621 (GRCm39) D395G probably damaging Het
Slc26a9 A T 1: 131,690,499 (GRCm39) N501I probably damaging Het
Slc9c1 A G 16: 45,401,965 (GRCm39) D784G possibly damaging Het
Snapc2 A G 8: 4,305,676 (GRCm39) D207G probably benign Het
Stard9 G T 2: 120,529,738 (GRCm39) M1998I probably benign Het
Stk38 A C 17: 29,194,907 (GRCm39) F280V possibly damaging Het
Tas2r126 A G 6: 42,412,025 (GRCm39) K186R probably damaging Het
Tdp1 A C 12: 99,875,970 (GRCm39) D307A probably benign Het
Tead2 A G 7: 44,866,674 (GRCm39) D11G probably damaging Het
Tmco4 C A 4: 138,747,383 (GRCm39) L211I probably damaging Het
Tmem183a A G 1: 134,280,115 (GRCm39) F255S probably damaging Het
Tmem87a C T 2: 120,205,929 (GRCm39) G349S possibly damaging Het
Tpte G A 8: 22,826,549 (GRCm39) E377K possibly damaging Het
Trim32 T C 4: 65,531,893 (GRCm39) F150S possibly damaging Het
Trpc7 T A 13: 57,035,636 (GRCm39) K99M probably damaging Het
Ttc22 A G 4: 106,491,381 (GRCm39) K195E probably damaging Het
Txn2 G A 15: 77,811,917 (GRCm39) P7S probably damaging Het
Ubxn2a G A 12: 4,930,700 (GRCm39) T220I probably damaging Het
Ufd1 A G 16: 18,633,626 (GRCm39) N17S possibly damaging Het
Unc13a A G 8: 72,102,509 (GRCm39) S958P probably damaging Het
Vmn1r202 T A 13: 22,685,824 (GRCm39) M198L probably damaging Het
Vmn2r84 G A 10: 130,221,991 (GRCm39) A743V probably damaging Het
Washc5 A G 15: 59,213,007 (GRCm39) F891S probably damaging Het
Zfp708 T C 13: 67,218,375 (GRCm39) T495A probably benign Het
Zfp81 A G 17: 33,553,593 (GRCm39) I407T probably benign Het
Zswim5 T C 4: 116,843,874 (GRCm39) probably null Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15,781,236 (GRCm39) missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15,383,147 (GRCm39) missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15,781,048 (GRCm39) missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15,383,178 (GRCm39) missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15,781,033 (GRCm39) missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15,780,085 (GRCm39) missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15,781,159 (GRCm39) missense probably benign
IGL02526:Kcnb2 APN 1 15,780,979 (GRCm39) missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15,780,730 (GRCm39) missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15,781,435 (GRCm39) missense probably benign
IGL03144:Kcnb2 APN 1 15,780,112 (GRCm39) missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15,383,200 (GRCm39) missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15,783,137 (GRCm39) unclassified probably benign
R0538:Kcnb2 UTSW 1 15,783,108 (GRCm39) unclassified probably benign
R1542:Kcnb2 UTSW 1 15,781,012 (GRCm39) missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15,779,979 (GRCm39) missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15,779,990 (GRCm39) missense possibly damaging 0.66
R2166:Kcnb2 UTSW 1 15,781,540 (GRCm39) missense possibly damaging 0.82
R2444:Kcnb2 UTSW 1 15,779,791 (GRCm39) missense probably benign
R3025:Kcnb2 UTSW 1 15,781,059 (GRCm39) missense possibly damaging 0.87
R3886:Kcnb2 UTSW 1 15,780,639 (GRCm39) missense probably damaging 1.00
R5010:Kcnb2 UTSW 1 15,383,186 (GRCm39) missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15,779,724 (GRCm39) missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15,781,068 (GRCm39) missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15,781,716 (GRCm39) missense probably benign
R5926:Kcnb2 UTSW 1 15,383,235 (GRCm39) missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15,780,790 (GRCm39) missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15,781,436 (GRCm39) missense probably benign
R6724:Kcnb2 UTSW 1 15,780,664 (GRCm39) missense probably damaging 1.00
R6981:Kcnb2 UTSW 1 15,780,480 (GRCm39) missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15,383,150 (GRCm39) missense probably benign
R7352:Kcnb2 UTSW 1 15,780,835 (GRCm39) missense probably benign
R7419:Kcnb2 UTSW 1 15,781,251 (GRCm39) missense possibly damaging 0.94
R7425:Kcnb2 UTSW 1 15,780,031 (GRCm39) missense probably damaging 1.00
R7606:Kcnb2 UTSW 1 15,383,064 (GRCm39) missense probably damaging 1.00
R7978:Kcnb2 UTSW 1 15,780,837 (GRCm39) missense probably benign 0.15
R7983:Kcnb2 UTSW 1 15,383,004 (GRCm39) missense probably damaging 0.98
R8115:Kcnb2 UTSW 1 15,781,851 (GRCm39) makesense probably null
R8156:Kcnb2 UTSW 1 15,780,280 (GRCm39) missense probably damaging 1.00
R8408:Kcnb2 UTSW 1 15,781,777 (GRCm39) missense probably damaging 1.00
R8439:Kcnb2 UTSW 1 15,382,934 (GRCm39) missense probably damaging 1.00
R8726:Kcnb2 UTSW 1 15,780,876 (GRCm39) missense probably benign 0.00
R8738:Kcnb2 UTSW 1 15,780,648 (GRCm39) missense probably benign 0.07
R9274:Kcnb2 UTSW 1 15,781,723 (GRCm39) missense probably benign
R9321:Kcnb2 UTSW 1 15,779,793 (GRCm39) missense possibly damaging 0.46
R9563:Kcnb2 UTSW 1 15,779,737 (GRCm39) missense probably damaging 1.00
R9633:Kcnb2 UTSW 1 15,781,444 (GRCm39) missense probably benign
R9709:Kcnb2 UTSW 1 15,780,523 (GRCm39) missense probably benign 0.31
V7580:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15,781,252 (GRCm39) missense probably benign 0.01
Z1088:Kcnb2 UTSW 1 15,780,315 (GRCm39) missense probably benign 0.03
Z1177:Kcnb2 UTSW 1 15,781,182 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTGGTGGGCTACCATCACCATGAC -3'
(R):5'- TCCTCATACACACATGGCCTCTCAG -3'

Sequencing Primer
(F):5'- GGCAGCATCGTTTCTATGAAC -3'
(R):5'- GGCCTCTCAGGCTGTTC -3'
Posted On 2013-07-11