Incidental Mutation 'R7036:Hoxc12'
ID546722
Institutional Source Beutler Lab
Gene Symbol Hoxc12
Ensembl Gene ENSMUSG00000050328
Gene Namehomeobox C12
SynonymsHox-3.8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7036 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location102936757-102938609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102938360 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 229 (G229D)
Ref Sequence ENSEMBL: ENSMUSP00000051003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055562]
Predicted Effect probably damaging
Transcript: ENSMUST00000055562
AA Change: G229D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051003
Gene: ENSMUSG00000050328
AA Change: G229D

DomainStartEndE-ValueType
low complexity region 101 129 N/A INTRINSIC
low complexity region 144 173 N/A INTRINSIC
HOX 212 274 1.05e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Ahnak2 A G 12: 112,778,781 probably benign Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Ank2 T C 3: 126,946,392 probably benign Het
Ank3 C T 10: 69,999,379 T680M probably damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Arl8a G C 1: 135,154,468 E145Q probably benign Het
Armc8 C T 9: 99,483,965 probably null Het
Arsj T C 3: 126,365,000 L76P probably damaging Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Bcl6 A T 16: 23,974,861 L112Q probably damaging Het
Bfsp1 T A 2: 143,826,923 T579S possibly damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Cd2ap A T 17: 42,798,599 L623Q probably damaging Het
Cerkl T C 2: 79,341,378 I379V probably benign Het
Cndp2 T A 18: 84,669,945 H307L possibly damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dixdc1 T A 9: 50,682,564 R254S probably benign Het
Dopey2 T A 16: 93,777,490 D30E probably benign Het
Duox2 T G 2: 122,280,453 H1513P probably damaging Het
Dyrk1a G A 16: 94,686,568 V546I probably benign Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Emc8 A T 8: 120,659,051 V108E probably benign Het
Epb41l1 A G 2: 156,529,402 T720A probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam71b G A 11: 46,407,408 S513N Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Fem1b T A 9: 62,797,028 I317F probably damaging Het
Focad A G 4: 88,124,637 E36G probably benign Het
Fryl C T 5: 73,055,608 E2275K probably benign Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gatad2a A T 8: 69,917,994 N114K probably damaging Het
Gcnt2 CTAATG C 13: 40,887,556 probably null Het
Gm884 T A 11: 103,615,812 probably benign Het
Gramd1a A G 7: 31,132,756 probably null Het
Gsn T A 2: 35,292,599 W187R probably damaging Het
Ints14 T C 9: 64,964,545 V55A probably benign Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Klf1 C T 8: 84,902,750 S68F possibly damaging Het
Kmt2e A G 5: 23,478,743 E333G probably null Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Lrp1b T C 2: 41,112,342 D2001G possibly damaging Het
Lrrc71 T C 3: 87,748,386 T27A probably benign Het
Lrrcc1 T C 3: 14,563,009 V958A possibly damaging Het
Med15 A T 16: 17,698,155 M1K probably null Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Nat10 T C 2: 103,754,108 N108S probably benign Het
Ncald A T 15: 37,368,878 S178T probably benign Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Olfr1167 T A 2: 88,149,125 D298V probably damaging Het
Olfr995 A G 2: 85,438,430 S243P probably damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Pcdhb4 T A 18: 37,308,782 C382S possibly damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Plcg2 G A 8: 117,596,306 R700H probably benign Het
Popdc2 A T 16: 38,362,811 Y52F probably damaging Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Pspc1 A C 14: 56,758,628 probably null Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rrh T C 3: 129,815,693 E55G possibly damaging Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Sds A T 5: 120,480,847 K125M possibly damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Tbx1 G T 16: 18,586,801 P38T unknown Het
Tcl1 T C 12: 105,217,601 probably benign Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdr70 T C 15: 7,884,374 D598G possibly damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Zfp872 C T 9: 22,200,560 P445L probably benign Het
Other mutations in Hoxc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Hoxc12 APN 15 102937320 missense probably benign
IGL01978:Hoxc12 APN 15 102936864 missense probably damaging 1.00
PIT4531001:Hoxc12 UTSW 15 102938420 missense probably damaging 1.00
R0724:Hoxc12 UTSW 15 102937055 missense probably damaging 0.99
R3748:Hoxc12 UTSW 15 102938378 missense probably damaging 1.00
R4448:Hoxc12 UTSW 15 102938476 missense probably damaging 1.00
R5151:Hoxc12 UTSW 15 102938446 missense probably damaging 1.00
R6376:Hoxc12 UTSW 15 102937089 missense possibly damaging 0.77
R7034:Hoxc12 UTSW 15 102938360 missense probably damaging 0.99
R7096:Hoxc12 UTSW 15 102937038 missense possibly damaging 0.79
R7295:Hoxc12 UTSW 15 102938375 missense probably damaging 0.97
X0028:Hoxc12 UTSW 15 102937458 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACATTTTCAGGATGAGAAGCG -3'
(R):5'- AAGGCAAGCTTAGTCTGGGG -3'

Sequencing Primer
(F):5'- CATTTTCAGGATGAGAAGCGAAAGG -3'
(R):5'- AAGCTTAGTCTGGGGCTAGCAC -3'
Posted On2019-05-13