Incidental Mutation 'R7036:Cd2ap'
ID546731
Institutional Source Beutler Lab
Gene Symbol Cd2ap
Ensembl Gene ENSMUSG00000061665
Gene NameCD2-associated protein
SynonymsMets1, METS-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7036 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location42792951-42876424 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42798599 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 623 (L623Q)
Ref Sequence ENSEMBL: ENSMUSP00000024709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024709]
PDB Structure
Third SH3 domain of CD2AP [SOLUTION NMR]
RDC refined solution structure of the first SH3 domain of CD2AP [SOLUTION NMR]
High resolution structure of the second SH3 domain of CD2AP [SOLUTION NMR]
RDC refined high resolution structure of the third SH3 domain of CD2AP [SOLUTION NMR]
Distinct ubiquitin binding modes exhibited by sh3 domains: molecular determinants and functional implications [SOLUTION NMR]
Distinct ubiquitin binding modes exhibited by SH3 domains: molecular determinants and functional implications [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000024709
AA Change: L623Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024709
Gene: ENSMUSG00000061665
AA Change: L623Q

DomainStartEndE-ValueType
SH3 2 58 4.48e-19 SMART
SH3 111 166 6.63e-22 SMART
low complexity region 183 195 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SH3 272 329 4.62e-21 SMART
low complexity region 336 352 N/A INTRINSIC
low complexity region 377 399 N/A INTRINSIC
low complexity region 410 422 N/A INTRINSIC
PDB:3LK4|9 475 503 2e-12 PDB
low complexity region 536 555 N/A INTRINSIC
coiled coil region 595 635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a scaffolding molecule that regulates the actin cytoskeleton. The protein directly interacts with filamentous actin and a variety of cell membrane proteins through multiple actin binding sites, SH3 domains, and a proline-rich region containing binding sites for SH3 domains. The cytoplasmic protein localizes to membrane ruffles, lipid rafts, and the leading edges of cells. It is implicated in dynamic actin remodeling and membrane trafficking that occurs during receptor endocytosis and cytokinesis. The mouse genome contains at least two pseudogenes located on chromosomes 9 and 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired immune function and die at 6 to 7 weeks of age from kidney failure associated with podocyte defects and mesangial cell hyperplasia. Heterozygotes develop glomerular changes around 9 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Ahnak2 A G 12: 112,778,781 probably benign Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Ank2 T C 3: 126,946,392 probably benign Het
Ank3 C T 10: 69,999,379 T680M probably damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Arl8a G C 1: 135,154,468 E145Q probably benign Het
Armc8 C T 9: 99,483,965 probably null Het
Arsj T C 3: 126,365,000 L76P probably damaging Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Bcl6 A T 16: 23,974,861 L112Q probably damaging Het
Bfsp1 T A 2: 143,826,923 T579S possibly damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Cerkl T C 2: 79,341,378 I379V probably benign Het
Cndp2 T A 18: 84,669,945 H307L possibly damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dixdc1 T A 9: 50,682,564 R254S probably benign Het
Dopey2 T A 16: 93,777,490 D30E probably benign Het
Duox2 T G 2: 122,280,453 H1513P probably damaging Het
Dyrk1a G A 16: 94,686,568 V546I probably benign Het
E130308A19Rik A C 4: 59,719,991 K508Q probably damaging Het
Emc8 A T 8: 120,659,051 V108E probably benign Het
Epb41l1 A G 2: 156,529,402 T720A probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam71b G A 11: 46,407,408 S513N Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Fem1b T A 9: 62,797,028 I317F probably damaging Het
Focad A G 4: 88,124,637 E36G probably benign Het
Fryl C T 5: 73,055,608 E2275K probably benign Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gatad2a A T 8: 69,917,994 N114K probably damaging Het
Gcnt2 CTAATG C 13: 40,887,556 probably null Het
Gm884 T A 11: 103,615,812 probably benign Het
Gramd1a A G 7: 31,132,756 probably null Het
Gsn T A 2: 35,292,599 W187R probably damaging Het
Hoxc12 G A 15: 102,938,360 G229D probably damaging Het
Ints14 T C 9: 64,964,545 V55A probably benign Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Klf1 C T 8: 84,902,750 S68F possibly damaging Het
Kmt2e A G 5: 23,478,743 E333G probably null Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Lrp1b T C 2: 41,112,342 D2001G possibly damaging Het
Lrrc71 T C 3: 87,748,386 T27A probably benign Het
Lrrcc1 T C 3: 14,563,009 V958A possibly damaging Het
Med15 A T 16: 17,698,155 M1K probably null Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Nat10 T C 2: 103,754,108 N108S probably benign Het
Ncald A T 15: 37,368,878 S178T probably benign Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Olfr1167 T A 2: 88,149,125 D298V probably damaging Het
Olfr995 A G 2: 85,438,430 S243P probably damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Pcdhb4 T A 18: 37,308,782 C382S possibly damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Plcg2 G A 8: 117,596,306 R700H probably benign Het
Popdc2 A T 16: 38,362,811 Y52F probably damaging Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Pspc1 A C 14: 56,758,628 probably null Het
Ptchd1 T A X: 155,574,712 Y499F probably damaging Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rrh T C 3: 129,815,693 E55G possibly damaging Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Sds A T 5: 120,480,847 K125M possibly damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Tbx1 G T 16: 18,586,801 P38T unknown Het
Tcl1 T C 12: 105,217,601 probably benign Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdr70 T C 15: 7,884,374 D598G possibly damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Zfp872 C T 9: 22,200,560 P445L probably benign Het
Other mutations in Cd2ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Cd2ap APN 17 42808785 missense probably benign 0.16
IGL00909:Cd2ap APN 17 42830114 splice site probably benign
IGL01321:Cd2ap APN 17 42845389 missense possibly damaging 0.71
IGL01350:Cd2ap APN 17 42825921 nonsense probably null
IGL01485:Cd2ap APN 17 42852474 missense probably damaging 1.00
IGL01834:Cd2ap APN 17 42826360 critical splice acceptor site probably null
IGL01834:Cd2ap APN 17 42826361 critical splice acceptor site probably null
PIT4494001:Cd2ap UTSW 17 42852367 critical splice donor site probably null
R0014:Cd2ap UTSW 17 42807928 missense probably benign
R0331:Cd2ap UTSW 17 42805301 missense probably benign 0.06
R0674:Cd2ap UTSW 17 42845392 missense possibly damaging 0.89
R1471:Cd2ap UTSW 17 42820597 missense probably benign 0.00
R1806:Cd2ap UTSW 17 42838758 nonsense probably null
R3858:Cd2ap UTSW 17 42816572 nonsense probably null
R3911:Cd2ap UTSW 17 42816089 critical splice acceptor site probably null
R3941:Cd2ap UTSW 17 42808799 missense probably damaging 0.99
R4766:Cd2ap UTSW 17 42852459 missense probably damaging 0.99
R5024:Cd2ap UTSW 17 42805345 splice site probably null
R5045:Cd2ap UTSW 17 42807960 missense probably benign 0.01
R6051:Cd2ap UTSW 17 42796328 makesense probably null
R6063:Cd2ap UTSW 17 42825911 missense probably benign 0.00
R7034:Cd2ap UTSW 17 42798599 missense probably damaging 1.00
R7214:Cd2ap UTSW 17 42845394 missense possibly damaging 0.61
R7299:Cd2ap UTSW 17 42830013 nonsense probably null
R7301:Cd2ap UTSW 17 42830013 nonsense probably null
R7402:Cd2ap UTSW 17 42805163 missense possibly damaging 0.88
R7851:Cd2ap UTSW 17 42824472 critical splice donor site probably null
R7934:Cd2ap UTSW 17 42824472 critical splice donor site probably null
Z1088:Cd2ap UTSW 17 42807993 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAATGACTCCCTAGGAAGC -3'
(R):5'- GAAGTTCCCTTTGTATGCAGTG -3'

Sequencing Primer
(F):5'- ACAAGGCCCCATGTGTGATTC -3'
(R):5'- CCCTTTGTATGCAGTGTGCTG -3'
Posted On2019-05-13