Incidental Mutation 'R7037:Atp6v1h'
ID546739
Institutional Source Beutler Lab
Gene Symbol Atp6v1h
Ensembl Gene ENSMUSG00000033793
Gene NameATPase, H+ transporting, lysosomal V1 subunit H
Synonyms0710001F19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7037 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location5070018-5162529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5149992 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 423 (M423K)
Ref Sequence ENSEMBL: ENSMUSP00000141797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044369] [ENSMUST00000192698] [ENSMUST00000192847]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044369
AA Change: M441K

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040756
Gene: ENSMUSG00000033793
AA Change: M441K

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 342 3e-106 PFAM
Pfam:V-ATPase_H_C 348 464 1.9e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192698
AA Change: M423K

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141797
Gene: ENSMUSG00000033793
AA Change: M423K

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 324 4.4e-104 PFAM
Pfam:V-ATPase_H_C 329 447 1.7e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192847
AA Change: M399K

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141636
Gene: ENSMUSG00000033793
AA Change: M399K

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 17 342 1e-102 PFAM
Pfam:V-ATPase_H_C 332 423 2.7e-25 PFAM
Pfam:Arm_2 339 427 4.6e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular organelles. V-ATPase-dependent organelle acidification is necessary for multiple processes including protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. The encoded protein is the regulatory H subunit of the V1 domain of V-ATPase, which is required for catalysis of ATP but not the assembly of V-ATPase. Decreased expression of this gene may play a role in the development of type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for the allele exhbit bone loss with altered bone absorption and decreased bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,768,043 N33I probably damaging Het
Ahnak2 A T 12: 112,774,278 V314D probably damaging Het
Arl14epl T G 18: 46,932,443 C92G probably benign Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b C T 2: 59,933,670 probably null Het
Bicral T C 17: 46,824,634 H550R probably benign Het
C1rl A G 6: 124,508,639 Y323C probably damaging Het
Ccr9 T A 9: 123,779,971 H239Q possibly damaging Het
Cdh16 T A 8: 104,617,635 R91* probably null Het
Coro1c A G 5: 113,845,396 F357S possibly damaging Het
Cpsf4 G A 5: 145,176,129 R141Q possibly damaging Het
Cryzl2 G A 1: 157,470,748 V236I probably damaging Het
Cttnbp2 T C 6: 18,435,118 E247G probably damaging Het
Dbr1 T A 9: 99,576,568 probably null Het
Dclk1 T C 3: 55,463,048 S23P probably damaging Het
Diexf A C 1: 193,120,723 probably null Het
Dpyd A T 3: 118,899,289 I361F probably benign Het
Elac2 A G 11: 64,983,711 E218G probably benign Het
Eml4 T A 17: 83,425,327 D136E probably benign Het
Fam198a G T 9: 121,965,526 V249L possibly damaging Het
Fam71e2 G T 7: 4,758,585 probably benign Het
Foxred1 A T 9: 35,207,548 S223T probably benign Het
Gm11595 A G 11: 99,772,648 C69R unknown Het
Gm14124 G T 2: 150,266,456 V46F possibly damaging Het
Gna14 A T 19: 16,533,764 H59L Het
H2-Ab1 T A 17: 34,267,989 I239N probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Itgb4 T A 11: 116,005,565 Y1379* probably null Het
Kank1 A G 19: 25,430,341 D1233G probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lrrc66 A T 5: 73,607,161 D846E probably benign Het
Lyst A G 13: 13,616,666 H38R probably damaging Het
Mc3r T C 2: 172,249,634 F259L probably damaging Het
Med25 A G 7: 44,882,782 Y384H probably damaging Het
Met A T 6: 17,547,128 probably benign Het
Mmp16 T C 4: 18,116,148 V584A possibly damaging Het
Mpp5 T A 12: 78,797,199 I59N probably damaging Het
Mrgprb3 A G 7: 48,643,194 L203P probably damaging Het
Mus81 A G 19: 5,486,080 L185P probably damaging Het
Naaa A G 5: 92,277,075 V75A possibly damaging Het
Obscn T A 11: 59,043,929 T5292S probably damaging Het
Obscn T C 11: 59,052,604 S4801G probably damaging Het
Olfr703 T C 7: 106,845,336 S242P probably damaging Het
Otof T C 5: 30,381,538 D1112G probably benign Het
Pbx4 A G 8: 69,864,875 R170G probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plce1 A T 19: 38,702,017 D715V probably damaging Het
Pms1 T C 1: 53,207,611 T311A possibly damaging Het
Popdc2 A G 16: 38,374,267 D350G probably damaging Het
Prex1 A G 2: 166,587,180 V661A probably benign Het
Ptbp2 A G 3: 119,751,908 Y130H probably damaging Het
Rev3l C T 10: 39,851,975 R2707W probably damaging Het
Rpl37 G A 15: 5,117,703 R75K probably null Het
Ryr3 T A 2: 112,949,130 R259* probably null Het
Scai A T 2: 39,190,621 S8T probably benign Het
Scn4a C A 11: 106,320,900 L1430F probably damaging Het
Sema5a A G 15: 32,686,847 K1035R probably damaging Het
Siah3 A G 14: 75,525,585 H92R probably benign Het
Smc4 G A 3: 69,018,195 V342I possibly damaging Het
Spata31d1a C T 13: 59,700,324 C1330Y possibly damaging Het
St18 C A 1: 6,803,036 H332N possibly damaging Het
Sycp1 T A 3: 102,898,934 E480D possibly damaging Het
Tex14 A T 11: 87,497,915 I323F probably damaging Het
Tm7sf2 A T 19: 6,064,077 probably null Het
Tmem241 G T 18: 12,113,406 H62Q probably benign Het
Tmem54 T A 4: 129,110,801 probably null Het
Tomm34 A G 2: 164,070,478 L39P probably damaging Het
Triml2 T A 8: 43,193,536 V354D probably damaging Het
Usp19 T C 9: 108,496,958 I738T possibly damaging Het
Utrn T A 10: 12,826,770 probably null Het
Other mutations in Atp6v1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Atp6v1h APN 1 5124471 critical splice donor site probably null
IGL00984:Atp6v1h APN 1 5095682 missense probably damaging 1.00
IGL01545:Atp6v1h APN 1 5089059 missense probably benign
IGL01788:Atp6v1h APN 1 5149983 missense possibly damaging 0.81
IGL02317:Atp6v1h APN 1 5084470 missense possibly damaging 0.95
IGL02679:Atp6v1h APN 1 5124302 missense probably damaging 1.00
IGL02944:Atp6v1h APN 1 5093355 splice site probably benign
IGL03119:Atp6v1h APN 1 5095669 missense probably benign 0.34
F5770:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
R0055:Atp6v1h UTSW 1 5084454 missense probably benign 0.01
R0055:Atp6v1h UTSW 1 5084454 missense probably benign 0.01
R0727:Atp6v1h UTSW 1 5084558 nonsense probably null
R1452:Atp6v1h UTSW 1 5098137 unclassified probably benign
R1465:Atp6v1h UTSW 1 5095688 missense probably damaging 1.00
R1465:Atp6v1h UTSW 1 5095688 missense probably damaging 1.00
R2273:Atp6v1h UTSW 1 5117476 missense probably damaging 1.00
R4512:Atp6v1h UTSW 1 5098135 critical splice donor site probably null
R4687:Atp6v1h UTSW 1 5133085 missense probably damaging 1.00
R5185:Atp6v1h UTSW 1 5095642 missense probably damaging 1.00
R5628:Atp6v1h UTSW 1 5135889 nonsense probably null
R5843:Atp6v1h UTSW 1 5162089 intron probably null
R7505:Atp6v1h UTSW 1 5124338 missense probably benign
V7580:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
V7581:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
V7582:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
V7583:Atp6v1h UTSW 1 5124443 missense possibly damaging 0.94
Z1088:Atp6v1h UTSW 1 5098048 missense probably damaging 1.00
Z1176:Atp6v1h UTSW 1 5095628 missense not run
Predicted Primers PCR Primer
(F):5'- GAGTGATGTAAGATGTAATGCTAGC -3'
(R):5'- AGCTGAAGTAATTTTGGGGTATCAG -3'

Sequencing Primer
(F):5'- TGTAAGATGTAATGCTAGCTTACTTC -3'
(R):5'- GGGGTATCAGAAATCTGTACCTTTC -3'
Posted On2019-05-13