Mutagenetix > Incidental Mutations

Incidental Mutation 'R7037:Baz2b'

546745

Institutional Source

Beutler Lab

Gene Symbol

Baz2b

Ensembl Gene

ENSMUSG00000026987

Gene Name

bromodomain adjacent to zinc finger domain, 2B

Synonyms

D2Ertd794e, 5830435C13Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.269) question?

Stock #

R7037 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59899363-60209839 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 59933670 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000118981 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090925] [ENSMUST00000112550] [ENSMUST00000153136]

Predicted Effect

probably null
Transcript: ENSMUST00000090925

SMART Domains

Protein: ENSMUSP00000088443
Gene: ENSMUSG00000026987

Domain	Start	End	E-Value	Type
low complexity region	7	46	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
low complexity region	147	162	N/A	INTRINSIC
low complexity region	193	244	N/A	INTRINSIC
low complexity region	291	308	N/A	INTRINSIC
low complexity region	366	385	N/A	INTRINSIC
low complexity region	528	540	N/A	INTRINSIC
low complexity region	554	614	N/A	INTRINSIC
low complexity region	628	637	N/A	INTRINSIC
low complexity region	671	685	N/A	INTRINSIC
Pfam:MBD	690	742	1e-12	PFAM
low complexity region	759	774	N/A	INTRINSIC
coiled coil region	814	975	N/A	INTRINSIC
DDT	1004	1069	1.19e-20	SMART
low complexity region	1199	1212	N/A	INTRINSIC
low complexity region	1213	1247	N/A	INTRINSIC
coiled coil region	1251	1286	N/A	INTRINSIC
low complexity region	1320	1337	N/A	INTRINSIC
low complexity region	1503	1524	N/A	INTRINSIC
low complexity region	1569	1582	N/A	INTRINSIC
low complexity region	1585	1605	N/A	INTRINSIC
Blast:BROMO	1802	1843	7e-18	BLAST
PHD	1888	1934	1.71e-12	SMART
low complexity region	1942	1964	N/A	INTRINSIC
low complexity region	1968	1980	N/A	INTRINSIC
BROMO	2013	2121	3.85e-41	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112550

SMART Domains

Protein: ENSMUSP00000108169
Gene: ENSMUSG00000026987

Domain	Start	End	E-Value	Type
low complexity region	7	46	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
low complexity region	147	162	N/A	INTRINSIC
low complexity region	193	244	N/A	INTRINSIC
low complexity region	291	308	N/A	INTRINSIC
low complexity region	366	385	N/A	INTRINSIC
low complexity region	528	540	N/A	INTRINSIC
low complexity region	554	614	N/A	INTRINSIC
low complexity region	628	637	N/A	INTRINSIC
low complexity region	671	685	N/A	INTRINSIC
Pfam:MBD	690	741	3.4e-13	PFAM
low complexity region	759	774	N/A	INTRINSIC
coiled coil region	814	975	N/A	INTRINSIC
DDT	1004	1069	1.19e-20	SMART
low complexity region	1199	1212	N/A	INTRINSIC
low complexity region	1213	1247	N/A	INTRINSIC
coiled coil region	1251	1286	N/A	INTRINSIC
low complexity region	1320	1337	N/A	INTRINSIC
low complexity region	1503	1524	N/A	INTRINSIC
low complexity region	1569	1582	N/A	INTRINSIC
low complexity region	1585	1605	N/A	INTRINSIC
Pfam:WHIM3	1638	1676	5.1e-14	PFAM
Blast:BROMO	1802	1843	7e-18	BLAST
PHD	1888	1934	1.71e-12	SMART
low complexity region	1942	1964	N/A	INTRINSIC
low complexity region	1968	1980	N/A	INTRINSIC
BROMO	2013	2121	3.85e-41	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000153136

SMART Domains

Protein: ENSMUSP00000118981
Gene: ENSMUSG00000026987

Domain	Start	End	E-Value	Type
coiled coil region	48	218	N/A	INTRINSIC
Pfam:DDT	247	296	1.6e-13	PFAM

Meta Mutation Damage Score

0.9483

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the bromodomain gene family. Members of this gene family encode proteins that are integral components of chromatin remodeling complexes. The encoded protein showed strong preference for the activating H3K14Ac mark in a histone peptide screen, suggesting a potential role in transcriptional activation. This gene may be associated with susceptibility to sudden cardiac death (SCD). [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm3	A	T	7: 119,768,043	N33I	probably damaging	Het
Ahnak2	A	T	12: 112,774,278	V314D	probably damaging	Het
Arl14epl	T	G	18: 46,932,443	C92G	probably benign	Het
Atp6v1h	T	A	1: 5,149,992	M423K	possibly damaging	Het
Baiap3	G	A	17: 25,243,840	R1075C	probably benign	Het
Bicral	T	C	17: 46,824,634	H550R	probably benign	Het
C1rl	A	G	6: 124,508,639	Y323C	probably damaging	Het
Ccr9	T	A	9: 123,779,971	H239Q	possibly damaging	Het
Cdh16	T	A	8: 104,617,635	R91*	probably null	Het
Coro1c	A	G	5: 113,845,396	F357S	possibly damaging	Het
Cpsf4	G	A	5: 145,176,129	R141Q	possibly damaging	Het
Cryzl2	G	A	1: 157,470,748	V236I	probably damaging	Het
Cttnbp2	T	C	6: 18,435,118	E247G	probably damaging	Het
Dbr1	T	A	9: 99,576,568		probably null	Het
Dclk1	T	C	3: 55,463,048	S23P	probably damaging	Het
Diexf	A	C	1: 193,120,723		probably null	Het
Dpyd	A	T	3: 118,899,289	I361F	probably benign	Het
Elac2	A	G	11: 64,983,711	E218G	probably benign	Het
Eml4	T	A	17: 83,425,327	D136E	probably benign	Het
Fam198a	G	T	9: 121,965,526	V249L	possibly damaging	Het
Fam71e2	G	T	7: 4,758,585		probably benign	Het
Foxred1	A	T	9: 35,207,548	S223T	probably benign	Het
Gm11595	A	G	11: 99,772,648	C69R	unknown	Het
Gm14124	G	T	2: 150,266,456	V46F	possibly damaging	Het
Gna14	A	T	19: 16,533,764	H59L		Het
H2-Ab1	T	A	17: 34,267,989	I239N	probably damaging	Het
Ints7	T	C	1: 191,619,605	S809P	probably benign	Het
Itgb4	T	A	11: 116,005,565	Y1379*	probably null	Het
Kank1	A	G	19: 25,430,341	D1233G	probably damaging	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Lrrc66	A	T	5: 73,607,161	D846E	probably benign	Het
Lyst	A	G	13: 13,616,666	H38R	probably damaging	Het
Mc3r	T	C	2: 172,249,634	F259L	probably damaging	Het
Med25	A	G	7: 44,882,782	Y384H	probably damaging	Het
Met	A	T	6: 17,547,128		probably benign	Het
Mmp16	T	C	4: 18,116,148	V584A	possibly damaging	Het
Mpp5	T	A	12: 78,797,199	I59N	probably damaging	Het
Mrgprb3	A	G	7: 48,643,194	L203P	probably damaging	Het
Mus81	A	G	19: 5,486,080	L185P	probably damaging	Het
Naaa	A	G	5: 92,277,075	V75A	possibly damaging	Het
Obscn	T	A	11: 59,043,929	T5292S	probably damaging	Het
Obscn	T	C	11: 59,052,604	S4801G	probably damaging	Het
Olfr703	T	C	7: 106,845,336	S242P	probably damaging	Het
Otof	T	C	5: 30,381,538	D1112G	probably benign	Het
Pbx4	A	G	8: 69,864,875	R170G	probably damaging	Het
Pigt	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	2: 164,499,669		probably null	Het
Plce1	A	T	19: 38,702,017	D715V	probably damaging	Het
Pms1	T	C	1: 53,207,611	T311A	possibly damaging	Het
Popdc2	A	G	16: 38,374,267	D350G	probably damaging	Het
Prex1	A	G	2: 166,587,180	V661A	probably benign	Het
Ptbp2	A	G	3: 119,751,908	Y130H	probably damaging	Het
Rev3l	C	T	10: 39,851,975	R2707W	probably damaging	Het
Rpl37	G	A	15: 5,117,703	R75K	probably null	Het
Ryr3	T	A	2: 112,949,130	R259*	probably null	Het
Scai	A	T	2: 39,190,621	S8T	probably benign	Het
Scn4a	C	A	11: 106,320,900	L1430F	probably damaging	Het
Sema5a	A	G	15: 32,686,847	K1035R	probably damaging	Het
Siah3	A	G	14: 75,525,585	H92R	probably benign	Het
Smc4	G	A	3: 69,018,195	V342I	possibly damaging	Het
Spata31d1a	C	T	13: 59,700,324	C1330Y	possibly damaging	Het
St18	C	A	1: 6,803,036	H332N	possibly damaging	Het
Sycp1	T	A	3: 102,898,934	E480D	possibly damaging	Het
Tex14	A	T	11: 87,497,915	I323F	probably damaging	Het
Tm7sf2	A	T	19: 6,064,077		probably null	Het
Tmem241	G	T	18: 12,113,406	H62Q	probably benign	Het
Tmem54	T	A	4: 129,110,801		probably null	Het
Tomm34	A	G	2: 164,070,478	L39P	probably damaging	Het
Triml2	T	A	8: 43,193,536	V354D	probably damaging	Het
Usp19	T	C	9: 108,496,958	I738T	possibly damaging	Het
Utrn	T	A	10: 12,826,770		probably null	Het

Other mutations in Baz2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Baz2b	APN	2	59912795	missense	probably benign	0.02
IGL00476:Baz2b	APN	2	59913739	missense	probably benign	0.06
IGL00489:Baz2b	APN	2	59957675	nonsense	probably null
IGL00514:Baz2b	APN	2	59962477	missense	probably benign	0.11
IGL00678:Baz2b	APN	2	60006183	missense	unknown
IGL01348:Baz2b	APN	2	59933687	missense	possibly damaging	0.95
IGL01354:Baz2b	APN	2	59968889	missense	probably benign	0.18
IGL01924:Baz2b	APN	2	59935271	missense	probably damaging	1.00
IGL02125:Baz2b	APN	2	59968640	missense	probably benign	0.12
IGL02314:Baz2b	APN	2	59962227	missense	probably benign
IGL02370:Baz2b	APN	2	59923589	missense	possibly damaging	0.77
IGL02473:Baz2b	APN	2	59960063	missense	probably benign	0.40
IGL02499:Baz2b	APN	2	59901496	missense	possibly damaging	0.60
IGL02609:Baz2b	APN	2	59917369	missense	possibly damaging	0.77
IGL02705:Baz2b	APN	2	59948260	missense	possibly damaging	0.92
IGL02711:Baz2b	APN	2	59917505	unclassified	probably benign
IGL02716:Baz2b	APN	2	59962524	missense	possibly damaging	0.53
IGL02724:Baz2b	APN	2	59977374	missense	possibly damaging	0.70
IGL02750:Baz2b	APN	2	59968658	missense	possibly damaging	0.73
IGL02869:Baz2b	APN	2	59977528	missense	probably benign	0.00
IGL02886:Baz2b	APN	2	59957743	splice site	probably null
IGL02892:Baz2b	APN	2	59900736	missense	probably damaging	1.00
IGL03132:Baz2b	APN	2	59907753	splice site	probably benign
IGL03183:Baz2b	APN	2	59903296	missense	probably benign	0.10
IGL03197:Baz2b	APN	2	59901554	missense	possibly damaging	0.74
R0054:Baz2b	UTSW	2	59932166	missense	probably damaging	1.00
R0054:Baz2b	UTSW	2	59932166	missense	probably damaging	1.00
R0122:Baz2b	UTSW	2	59913619	unclassified	probably null
R0136:Baz2b	UTSW	2	59901954	missense	probably benign	0.22
R0144:Baz2b	UTSW	2	59907495	missense	probably damaging	0.98
R0403:Baz2b	UTSW	2	59969377	missense	possibly damaging	0.70
R0498:Baz2b	UTSW	2	59901996	unclassified	probably benign
R0528:Baz2b	UTSW	2	59936739	missense	probably damaging	1.00
R1025:Baz2b	UTSW	2	59962482	missense	probably benign	0.06
R1470:Baz2b	UTSW	2	59978546	missense	possibly damaging	0.53
R1470:Baz2b	UTSW	2	59978546	missense	possibly damaging	0.53
R1510:Baz2b	UTSW	2	59922209	missense	probably damaging	1.00
R1511:Baz2b	UTSW	2	59962024	missense	probably benign	0.12
R1514:Baz2b	UTSW	2	59962326	missense	probably benign	0.13
R1519:Baz2b	UTSW	2	59948254	missense	possibly damaging	0.50
R1523:Baz2b	UTSW	2	59968637	missense	possibly damaging	0.47
R1630:Baz2b	UTSW	2	60006130	missense	unknown
R1641:Baz2b	UTSW	2	59912890	missense	probably damaging	0.99
R1674:Baz2b	UTSW	2	59912992	missense	possibly damaging	0.53
R1778:Baz2b	UTSW	2	60006136	missense	unknown
R1826:Baz2b	UTSW	2	59968733	missense	probably benign	0.12
R1835:Baz2b	UTSW	2	59901819	missense	probably benign	0.02
R1954:Baz2b	UTSW	2	59968743	missense	probably benign	0.12
R1981:Baz2b	UTSW	2	59923680	missense	possibly damaging	0.95
R2029:Baz2b	UTSW	2	59912723	unclassified	probably benign
R2567:Baz2b	UTSW	2	59913911	missense	possibly damaging	0.82
R2842:Baz2b	UTSW	2	59913004	missense	probably benign	0.27
R2848:Baz2b	UTSW	2	59924666	missense	possibly damaging	0.64
R3809:Baz2b	UTSW	2	59968896	missense	probably benign	0.12
R3935:Baz2b	UTSW	2	59912761	missense	possibly damaging	0.81
R3936:Baz2b	UTSW	2	59912761	missense	possibly damaging	0.81
R4072:Baz2b	UTSW	2	59912573	intron	probably null
R4182:Baz2b	UTSW	2	60098457	intron	probably benign
R4255:Baz2b	UTSW	2	59920572	unclassified	probably benign
R4359:Baz2b	UTSW	2	59901613	missense	possibly damaging	0.87
R4716:Baz2b	UTSW	2	59969255	missense	probably benign	0.06
R4743:Baz2b	UTSW	2	59913911	missense	probably benign	0.01
R4772:Baz2b	UTSW	2	59958451	missense	probably damaging	0.96
R4858:Baz2b	UTSW	2	59907743	missense	probably benign
R4868:Baz2b	UTSW	2	59924882	missense	possibly damaging	0.65
R4872:Baz2b	UTSW	2	59942759	splice site	probably null
R4889:Baz2b	UTSW	2	59936726	missense	probably damaging	1.00
R4890:Baz2b	UTSW	2	59926039	missense	probably damaging	0.99
R4914:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R4915:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R4918:Baz2b	UTSW	2	59914043	missense	possibly damaging	0.70
R5027:Baz2b	UTSW	2	60098644	intron	probably benign
R5031:Baz2b	UTSW	2	59912807	missense	probably benign	0.00
R5082:Baz2b	UTSW	2	59901491	nonsense	probably null
R5133:Baz2b	UTSW	2	59962024	missense	probably benign	0.12
R5276:Baz2b	UTSW	2	59962614	missense	probably benign	0.40
R5279:Baz2b	UTSW	2	59932152	missense	probably damaging	1.00
R5294:Baz2b	UTSW	2	59978602	missense	probably benign	0.11
R5447:Baz2b	UTSW	2	59913988	missense	probably damaging	0.99
R5903:Baz2b	UTSW	2	59959889	missense	probably damaging	0.99
R5910:Baz2b	UTSW	2	59977426	missense	possibly damaging	0.88
R6140:Baz2b	UTSW	2	59912527	missense	probably damaging	0.99
R6195:Baz2b	UTSW	2	59907511	missense	possibly damaging	0.89
R6199:Baz2b	UTSW	2	59978675	missense	probably benign	0.00
R6208:Baz2b	UTSW	2	59924806	missense	probably damaging	1.00
R6233:Baz2b	UTSW	2	59907511	missense	possibly damaging	0.89
R6276:Baz2b	UTSW	2	59948223	missense	probably damaging	1.00
R6324:Baz2b	UTSW	2	59906948	missense	probably damaging	1.00
R6490:Baz2b	UTSW	2	59901729	missense	probably damaging	1.00
R6578:Baz2b	UTSW	2	59969279	missense	possibly damaging	0.47
R6720:Baz2b	UTSW	2	59924890	missense	probably damaging	1.00
R6760:Baz2b	UTSW	2	59962432	missense	probably benign	0.40
R6836:Baz2b	UTSW	2	59917425	missense	probably damaging	1.00
R6859:Baz2b	UTSW	2	59901530	missense	probably benign	0.01
R6880:Baz2b	UTSW	2	59912939	missense	probably damaging	0.99
R6916:Baz2b	UTSW	2	59968776	missense	probably benign
R6978:Baz2b	UTSW	2	59907715	missense	possibly damaging	0.84
R7112:Baz2b	UTSW	2	59962184	missense	possibly damaging	0.53
R7117:Baz2b	UTSW	2	59912497	missense
R7198:Baz2b	UTSW	2	59962206	missense	probably benign	0.00
R7270:Baz2b	UTSW	2	59962492	missense	possibly damaging	0.96
R7282:Baz2b	UTSW	2	59920437	missense	probably benign	0.17
R7464:Baz2b	UTSW	2	59977448	missense	possibly damaging	0.53
R7609:Baz2b	UTSW	2	59962473	missense	probably benign	0.40
R7703:Baz2b	UTSW	2	59917425	missense	probably damaging	1.00
R7850:Baz2b	UTSW	2	59936716	missense	probably damaging	0.98
R7851:Baz2b	UTSW	2	59936716	missense	probably damaging	0.98
R7933:Baz2b	UTSW	2	59936716	missense	probably damaging	0.98
R7934:Baz2b	UTSW	2	59936716	missense	probably damaging	0.98
X0011:Baz2b	UTSW	2	59977361	missense	possibly damaging	0.53
X0053:Baz2b	UTSW	2	59900675	missense	probably damaging	1.00
X0064:Baz2b	UTSW	2	59969282	missense	probably benign
Z1088:Baz2b	UTSW	2	59960015	missense	probably damaging	1.00
Z1177:Baz2b	UTSW	2	59977520	missense	not run

Predicted Primers

PCR Primer
(F):5'- CTCCTGGGAGAAAGAGTTGG -3'
(R):5'- CGCCAGTTAAGAGTGAATGGTC -3'

Sequencing Primer
(F):5'- TGGCACAACATTATGGAACAGAAATC -3'
(R):5'- GTCAGCTTTTTCTGTAGCTAAAGC -3'

Posted On

2019-05-13