Incidental Mutation 'R7037:Gm14124'
ID546747
Institutional Source Beutler Lab
Gene Symbol Gm14124
Ensembl Gene ENSMUSG00000079008
Gene Namepredicted gene 14124
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7037 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location150257517-150270300 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 150266456 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 46 (V46F)
Ref Sequence ENSEMBL: ENSMUSP00000105548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109922]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109922
AA Change: V46F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105548
Gene: ENSMUSG00000079008
AA Change: V46F

DomainStartEndE-ValueType
KRAB 4 66 9.26e-19 SMART
ZnF_C2H2 103 125 7.49e-5 SMART
ZnF_C2H2 131 151 9.46e0 SMART
ZnF_C2H2 159 181 5.9e-3 SMART
ZnF_C2H2 187 209 6.67e-2 SMART
ZnF_C2H2 215 237 4.87e-4 SMART
ZnF_C2H2 243 265 2.82e0 SMART
ZnF_C2H2 271 293 2.2e2 SMART
ZnF_C2H2 299 321 1.4e-4 SMART
ZnF_C2H2 327 349 1.6e-4 SMART
ZnF_C2H2 355 377 1.18e-2 SMART
ZnF_C2H2 383 405 1.38e-3 SMART
ZnF_C2H2 411 433 9.56e1 SMART
ZnF_C2H2 439 461 6.99e-5 SMART
ZnF_C2H2 467 489 2.99e-4 SMART
ZnF_C2H2 495 517 7.78e-3 SMART
ZnF_C2H2 523 545 1.04e-3 SMART
ZnF_C2H2 551 573 1.6e-4 SMART
ZnF_C2H2 579 601 1.18e-2 SMART
ZnF_C2H2 607 629 4.54e-4 SMART
ZnF_C2H2 635 657 4.24e-4 SMART
ZnF_C2H2 663 685 1.2e-3 SMART
ZnF_C2H2 691 713 8.47e-4 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,768,043 N33I probably damaging Het
Ahnak2 A T 12: 112,774,278 V314D probably damaging Het
Arl14epl T G 18: 46,932,443 C92G probably benign Het
Atp6v1h T A 1: 5,149,992 M423K possibly damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b C T 2: 59,933,670 probably null Het
Bicral T C 17: 46,824,634 H550R probably benign Het
C1rl A G 6: 124,508,639 Y323C probably damaging Het
Ccr9 T A 9: 123,779,971 H239Q possibly damaging Het
Cdh16 T A 8: 104,617,635 R91* probably null Het
Coro1c A G 5: 113,845,396 F357S possibly damaging Het
Cpsf4 G A 5: 145,176,129 R141Q possibly damaging Het
Cryzl2 G A 1: 157,470,748 V236I probably damaging Het
Cttnbp2 T C 6: 18,435,118 E247G probably damaging Het
Dbr1 T A 9: 99,576,568 probably null Het
Dclk1 T C 3: 55,463,048 S23P probably damaging Het
Diexf A C 1: 193,120,723 probably null Het
Dpyd A T 3: 118,899,289 I361F probably benign Het
Elac2 A G 11: 64,983,711 E218G probably benign Het
Eml4 T A 17: 83,425,327 D136E probably benign Het
Fam198a G T 9: 121,965,526 V249L possibly damaging Het
Fam71e2 G T 7: 4,758,585 probably benign Het
Foxred1 A T 9: 35,207,548 S223T probably benign Het
Gm11595 A G 11: 99,772,648 C69R unknown Het
Gna14 A T 19: 16,533,764 H59L Het
H2-Ab1 T A 17: 34,267,989 I239N probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Itgb4 T A 11: 116,005,565 Y1379* probably null Het
Kank1 A G 19: 25,430,341 D1233G probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lrrc66 A T 5: 73,607,161 D846E probably benign Het
Lyst A G 13: 13,616,666 H38R probably damaging Het
Mc3r T C 2: 172,249,634 F259L probably damaging Het
Med25 A G 7: 44,882,782 Y384H probably damaging Het
Met A T 6: 17,547,128 probably benign Het
Mmp16 T C 4: 18,116,148 V584A possibly damaging Het
Mpp5 T A 12: 78,797,199 I59N probably damaging Het
Mrgprb3 A G 7: 48,643,194 L203P probably damaging Het
Mus81 A G 19: 5,486,080 L185P probably damaging Het
Naaa A G 5: 92,277,075 V75A possibly damaging Het
Obscn T A 11: 59,043,929 T5292S probably damaging Het
Obscn T C 11: 59,052,604 S4801G probably damaging Het
Olfr703 T C 7: 106,845,336 S242P probably damaging Het
Otof T C 5: 30,381,538 D1112G probably benign Het
Pbx4 A G 8: 69,864,875 R170G probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plce1 A T 19: 38,702,017 D715V probably damaging Het
Pms1 T C 1: 53,207,611 T311A possibly damaging Het
Popdc2 A G 16: 38,374,267 D350G probably damaging Het
Prex1 A G 2: 166,587,180 V661A probably benign Het
Ptbp2 A G 3: 119,751,908 Y130H probably damaging Het
Rev3l C T 10: 39,851,975 R2707W probably damaging Het
Rpl37 G A 15: 5,117,703 R75K probably null Het
Ryr3 T A 2: 112,949,130 R259* probably null Het
Scai A T 2: 39,190,621 S8T probably benign Het
Scn4a C A 11: 106,320,900 L1430F probably damaging Het
Sema5a A G 15: 32,686,847 K1035R probably damaging Het
Siah3 A G 14: 75,525,585 H92R probably benign Het
Smc4 G A 3: 69,018,195 V342I possibly damaging Het
Spata31d1a C T 13: 59,700,324 C1330Y possibly damaging Het
St18 C A 1: 6,803,036 H332N possibly damaging Het
Sycp1 T A 3: 102,898,934 E480D possibly damaging Het
Tex14 A T 11: 87,497,915 I323F probably damaging Het
Tm7sf2 A T 19: 6,064,077 probably null Het
Tmem241 G T 18: 12,113,406 H62Q probably benign Het
Tmem54 T A 4: 129,110,801 probably null Het
Tomm34 A G 2: 164,070,478 L39P probably damaging Het
Triml2 T A 8: 43,193,536 V354D probably damaging Het
Usp19 T C 9: 108,496,958 I738T possibly damaging Het
Utrn T A 10: 12,826,770 probably null Het
Other mutations in Gm14124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:Gm14124 APN 2 150266443 splice site probably benign
R0220:Gm14124 UTSW 2 150268675 missense unknown
R0396:Gm14124 UTSW 2 150268053 missense probably damaging 1.00
R0402:Gm14124 UTSW 2 150269216 missense possibly damaging 0.93
R0446:Gm14124 UTSW 2 150268073 missense possibly damaging 0.71
R0462:Gm14124 UTSW 2 150269202 missense possibly damaging 0.80
R0507:Gm14124 UTSW 2 150268124 missense possibly damaging 0.69
R0605:Gm14124 UTSW 2 150268603 missense unknown
R0838:Gm14124 UTSW 2 150269300 missense possibly damaging 0.74
R1327:Gm14124 UTSW 2 150266150 missense possibly damaging 0.71
R1405:Gm14124 UTSW 2 150267700 nonsense probably null
R1405:Gm14124 UTSW 2 150267700 nonsense probably null
R2114:Gm14124 UTSW 2 150267899 missense unknown
R2140:Gm14124 UTSW 2 150269361 missense probably benign 0.33
R3683:Gm14124 UTSW 2 150268056 missense probably benign 0.41
R3917:Gm14124 UTSW 2 150266119 splice site probably benign
R4084:Gm14124 UTSW 2 150266202 missense possibly damaging 0.85
R4499:Gm14124 UTSW 2 150269442 missense possibly damaging 0.93
R4683:Gm14124 UTSW 2 150266470 missense possibly damaging 0.53
R4762:Gm14124 UTSW 2 150267629 missense possibly damaging 0.53
R4937:Gm14124 UTSW 2 150268760 missense unknown
R5678:Gm14124 UTSW 2 150268505 nonsense probably null
R5696:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5697:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5698:Gm14124 UTSW 2 150269474 missense possibly damaging 0.52
R5769:Gm14124 UTSW 2 150268278 missense possibly damaging 0.87
R5780:Gm14124 UTSW 2 150266219 missense probably benign 0.05
R5973:Gm14124 UTSW 2 150267935 missense unknown
R6662:Gm14124 UTSW 2 150266252 critical splice donor site probably null
R6878:Gm14124 UTSW 2 150266486 missense possibly damaging 0.86
R7081:Gm14124 UTSW 2 150268269 missense possibly damaging 0.66
R7413:Gm14124 UTSW 2 150266161 missense possibly damaging 0.93
R7725:Gm14124 UTSW 2 150268548 missense unknown
R7781:Gm14124 UTSW 2 150267657 missense possibly damaging 0.53
X0022:Gm14124 UTSW 2 150267658 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TTTAGGGTAGAGTGACCTATGATGATG -3'
(R):5'- GCAATTCTTCAGCATAGCCCTATT -3'

Sequencing Primer
(F):5'- CTACAGGAATCTCGCTGCTATAGG -3'
(R):5'- ACTTAGAGGAATGGTTTGAAAACAC -3'
Posted On2019-05-13