Incidental Mutation 'R7037:Triml2'
ID546771
Institutional Source Beutler Lab
Gene Symbol Triml2
Ensembl Gene ENSMUSG00000091490
Gene Nametripartite motif family-like 2
SynonymsEG622117
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7037 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location43180541-43193881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43193536 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 354 (V354D)
Ref Sequence ENSEMBL: ENSMUSP00000148196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163869] [ENSMUST00000209200] [ENSMUST00000209872] [ENSMUST00000210136]
Predicted Effect probably damaging
Transcript: ENSMUST00000163869
AA Change: V354D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132971
Gene: ENSMUSG00000091490
AA Change: V354D

DomainStartEndE-ValueType
Pfam:zf-B_box 13 51 7e-7 PFAM
PRY 242 294 2.86e-14 SMART
Pfam:SPRY 297 414 2.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209200
AA Change: V354D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000209872
AA Change: V307D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000210136
AA Change: V354D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tri-partite motif (TRIM) family of proteins. This protein may be regulated by the tumor suppressor p53 and may regulate p53 through the enhancement of p53 SUMOylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,768,043 N33I probably damaging Het
Ahnak2 A T 12: 112,774,278 V314D probably damaging Het
Arl14epl T G 18: 46,932,443 C92G probably benign Het
Atp6v1h T A 1: 5,149,992 M423K possibly damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b C T 2: 59,933,670 probably null Het
Bicral T C 17: 46,824,634 H550R probably benign Het
C1rl A G 6: 124,508,639 Y323C probably damaging Het
Ccr9 T A 9: 123,779,971 H239Q possibly damaging Het
Cdh16 T A 8: 104,617,635 R91* probably null Het
Coro1c A G 5: 113,845,396 F357S possibly damaging Het
Cpsf4 G A 5: 145,176,129 R141Q possibly damaging Het
Cryzl2 G A 1: 157,470,748 V236I probably damaging Het
Cttnbp2 T C 6: 18,435,118 E247G probably damaging Het
Dbr1 T A 9: 99,576,568 probably null Het
Dclk1 T C 3: 55,463,048 S23P probably damaging Het
Diexf A C 1: 193,120,723 probably null Het
Dpyd A T 3: 118,899,289 I361F probably benign Het
Elac2 A G 11: 64,983,711 E218G probably benign Het
Eml4 T A 17: 83,425,327 D136E probably benign Het
Fam198a G T 9: 121,965,526 V249L possibly damaging Het
Fam71e2 G T 7: 4,758,585 probably benign Het
Foxred1 A T 9: 35,207,548 S223T probably benign Het
Gm11595 A G 11: 99,772,648 C69R unknown Het
Gm14124 G T 2: 150,266,456 V46F possibly damaging Het
Gna14 A T 19: 16,533,764 H59L Het
H2-Ab1 T A 17: 34,267,989 I239N probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Itgb4 T A 11: 116,005,565 Y1379* probably null Het
Kank1 A G 19: 25,430,341 D1233G probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lrrc66 A T 5: 73,607,161 D846E probably benign Het
Lyst A G 13: 13,616,666 H38R probably damaging Het
Mc3r T C 2: 172,249,634 F259L probably damaging Het
Med25 A G 7: 44,882,782 Y384H probably damaging Het
Met A T 6: 17,547,128 probably benign Het
Mmp16 T C 4: 18,116,148 V584A possibly damaging Het
Mpp5 T A 12: 78,797,199 I59N probably damaging Het
Mrgprb3 A G 7: 48,643,194 L203P probably damaging Het
Mus81 A G 19: 5,486,080 L185P probably damaging Het
Naaa A G 5: 92,277,075 V75A possibly damaging Het
Obscn T A 11: 59,043,929 T5292S probably damaging Het
Obscn T C 11: 59,052,604 S4801G probably damaging Het
Olfr703 T C 7: 106,845,336 S242P probably damaging Het
Otof T C 5: 30,381,538 D1112G probably benign Het
Pbx4 A G 8: 69,864,875 R170G probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plce1 A T 19: 38,702,017 D715V probably damaging Het
Pms1 T C 1: 53,207,611 T311A possibly damaging Het
Popdc2 A G 16: 38,374,267 D350G probably damaging Het
Prex1 A G 2: 166,587,180 V661A probably benign Het
Ptbp2 A G 3: 119,751,908 Y130H probably damaging Het
Rev3l C T 10: 39,851,975 R2707W probably damaging Het
Rpl37 G A 15: 5,117,703 R75K probably null Het
Ryr3 T A 2: 112,949,130 R259* probably null Het
Scai A T 2: 39,190,621 S8T probably benign Het
Scn4a C A 11: 106,320,900 L1430F probably damaging Het
Sema5a A G 15: 32,686,847 K1035R probably damaging Het
Siah3 A G 14: 75,525,585 H92R probably benign Het
Smc4 G A 3: 69,018,195 V342I possibly damaging Het
Spata31d1a C T 13: 59,700,324 C1330Y possibly damaging Het
St18 C A 1: 6,803,036 H332N possibly damaging Het
Sycp1 T A 3: 102,898,934 E480D possibly damaging Het
Tex14 A T 11: 87,497,915 I323F probably damaging Het
Tm7sf2 A T 19: 6,064,077 probably null Het
Tmem241 G T 18: 12,113,406 H62Q probably benign Het
Tmem54 T A 4: 129,110,801 probably null Het
Tomm34 A G 2: 164,070,478 L39P probably damaging Het
Usp19 T C 9: 108,496,958 I738T possibly damaging Het
Utrn T A 10: 12,826,770 probably null Het
Other mutations in Triml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Triml2 APN 8 43187623 missense probably benign 0.00
IGL01919:Triml2 APN 8 43190312 missense probably damaging 1.00
IGL03382:Triml2 APN 8 43193739 missense probably benign 0.00
R0025:Triml2 UTSW 8 43185432 missense probably benign 0.00
R0058:Triml2 UTSW 8 43185269 splice site probably benign
R0058:Triml2 UTSW 8 43185269 splice site probably benign
R0180:Triml2 UTSW 8 43190309 missense probably benign 0.14
R1671:Triml2 UTSW 8 43183743 missense possibly damaging 0.88
R2143:Triml2 UTSW 8 43193511 missense probably damaging 1.00
R2210:Triml2 UTSW 8 43183360 missense probably damaging 1.00
R3156:Triml2 UTSW 8 43187679 missense probably benign 0.10
R3902:Triml2 UTSW 8 43190360 missense probably benign 0.03
R4981:Triml2 UTSW 8 43187680 missense probably benign 0.10
R6125:Triml2 UTSW 8 43187622 missense probably benign 0.02
R6478:Triml2 UTSW 8 43185128 unclassified probably null
R6994:Triml2 UTSW 8 43190078 missense possibly damaging 0.57
R7113:Triml2 UTSW 8 43183333 missense probably benign 0.01
R7660:Triml2 UTSW 8 43193320 missense probably damaging 1.00
R7683:Triml2 UTSW 8 43185288 missense probably damaging 0.99
RF011:Triml2 UTSW 8 43183164 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACCACGGGGAGGCATTATTG -3'
(R):5'- GCATTTCAGGGATGAGTCTGAG -3'

Sequencing Primer
(F):5'- AGGCATTATTGGGAGGTGGC -3'
(R):5'- TCTGAGGAAGACAGACAGTGAG -3'
Posted On2019-05-13