Mutagenetix > Incidental Mutations

Incidental Mutation 'R7037:Rev3l'

546778

Institutional Source

Beutler Lab

Gene Symbol

Rev3l

Ensembl Gene

ENSMUSG00000019841

Gene Name

REV3 like, DNA directed polymerase zeta catalytic subunit

Synonyms

Sez4, Rev

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7037 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

39732118-39875211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 39851975 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 2707 (R2707W)

Ref Sequence

ENSEMBL: ENSMUSP00000131519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]

Predicted Effect

probably damaging
Transcript: ENSMUST00000019986
AA Change: R2707W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: R2707W

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	201	1.6e-10	PFAM
low complexity region	494	506	N/A	INTRINSIC
low complexity region	959	969	N/A	INTRINSIC
low complexity region	1042	1057	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3103	8.2e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131186

Predicted Effect

probably benign
Transcript: ENSMUST00000139803

SMART Domains

Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

Domain	Start	End	E-Value	Type
Blast:POLBc	1	369	1e-155	BLAST
POLBc	434	805	4.77e-34	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000164763
AA Change: R2707W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: R2707W

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	200	1.3e-11	PFAM
low complexity region	494	506	N/A	INTRINSIC
Pfam:DUF4683	745	1132	1.7e-162	PFAM
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3102	6.1e-15	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm3	A	T	7: 119,768,043	N33I	probably damaging	Het
Ahnak2	A	T	12: 112,774,278	V314D	probably damaging	Het
Arl14epl	T	G	18: 46,932,443	C92G	probably benign	Het
Atp6v1h	T	A	1: 5,149,992	M423K	possibly damaging	Het
Baiap3	G	A	17: 25,243,840	R1075C	probably benign	Het
Baz2b	C	T	2: 59,933,670		probably null	Het
Bicral	T	C	17: 46,824,634	H550R	probably benign	Het
C1rl	A	G	6: 124,508,639	Y323C	probably damaging	Het
Ccr9	T	A	9: 123,779,971	H239Q	possibly damaging	Het
Cdh16	T	A	8: 104,617,635	R91*	probably null	Het
Coro1c	A	G	5: 113,845,396	F357S	possibly damaging	Het
Cpsf4	G	A	5: 145,176,129	R141Q	possibly damaging	Het
Cryzl2	G	A	1: 157,470,748	V236I	probably damaging	Het
Cttnbp2	T	C	6: 18,435,118	E247G	probably damaging	Het
Dbr1	T	A	9: 99,576,568		probably null	Het
Dclk1	T	C	3: 55,463,048	S23P	probably damaging	Het
Diexf	A	C	1: 193,120,723		probably null	Het
Dpyd	A	T	3: 118,899,289	I361F	probably benign	Het
Elac2	A	G	11: 64,983,711	E218G	probably benign	Het
Eml4	T	A	17: 83,425,327	D136E	probably benign	Het
Fam198a	G	T	9: 121,965,526	V249L	possibly damaging	Het
Fam71e2	G	T	7: 4,758,585		probably benign	Het
Foxred1	A	T	9: 35,207,548	S223T	probably benign	Het
Gm11595	A	G	11: 99,772,648	C69R	unknown	Het
Gm14124	G	T	2: 150,266,456	V46F	possibly damaging	Het
Gna14	A	T	19: 16,533,764	H59L		Het
H2-Ab1	T	A	17: 34,267,989	I239N	probably damaging	Het
Ints7	T	C	1: 191,619,605	S809P	probably benign	Het
Itgb4	T	A	11: 116,005,565	Y1379*	probably null	Het
Kank1	A	G	19: 25,430,341	D1233G	probably damaging	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Lrrc66	A	T	5: 73,607,161	D846E	probably benign	Het
Lyst	A	G	13: 13,616,666	H38R	probably damaging	Het
Mc3r	T	C	2: 172,249,634	F259L	probably damaging	Het
Med25	A	G	7: 44,882,782	Y384H	probably damaging	Het
Met	A	T	6: 17,547,128		probably benign	Het
Mmp16	T	C	4: 18,116,148	V584A	possibly damaging	Het
Mpp5	T	A	12: 78,797,199	I59N	probably damaging	Het
Mrgprb3	A	G	7: 48,643,194	L203P	probably damaging	Het
Mus81	A	G	19: 5,486,080	L185P	probably damaging	Het
Naaa	A	G	5: 92,277,075	V75A	possibly damaging	Het
Obscn	T	A	11: 59,043,929	T5292S	probably damaging	Het
Obscn	T	C	11: 59,052,604	S4801G	probably damaging	Het
Olfr703	T	C	7: 106,845,336	S242P	probably damaging	Het
Otof	T	C	5: 30,381,538	D1112G	probably benign	Het
Pbx4	A	G	8: 69,864,875	R170G	probably damaging	Het
Pigt	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	2: 164,499,669		probably null	Het
Plce1	A	T	19: 38,702,017	D715V	probably damaging	Het
Pms1	T	C	1: 53,207,611	T311A	possibly damaging	Het
Popdc2	A	G	16: 38,374,267	D350G	probably damaging	Het
Prex1	A	G	2: 166,587,180	V661A	probably benign	Het
Ptbp2	A	G	3: 119,751,908	Y130H	probably damaging	Het
Rpl37	G	A	15: 5,117,703	R75K	probably null	Het
Ryr3	T	A	2: 112,949,130	R259*	probably null	Het
Scai	A	T	2: 39,190,621	S8T	probably benign	Het
Scn4a	C	A	11: 106,320,900	L1430F	probably damaging	Het
Sema5a	A	G	15: 32,686,847	K1035R	probably damaging	Het
Siah3	A	G	14: 75,525,585	H92R	probably benign	Het
Smc4	G	A	3: 69,018,195	V342I	possibly damaging	Het
Spata31d1a	C	T	13: 59,700,324	C1330Y	possibly damaging	Het
St18	C	A	1: 6,803,036	H332N	possibly damaging	Het
Sycp1	T	A	3: 102,898,934	E480D	possibly damaging	Het
Tex14	A	T	11: 87,497,915	I323F	probably damaging	Het
Tm7sf2	A	T	19: 6,064,077		probably null	Het
Tmem241	G	T	18: 12,113,406	H62Q	probably benign	Het
Tmem54	T	A	4: 129,110,801		probably null	Het
Tomm34	A	G	2: 164,070,478	L39P	probably damaging	Het
Triml2	T	A	8: 43,193,536	V354D	probably damaging	Het
Usp19	T	C	9: 108,496,958	I738T	possibly damaging	Het
Utrn	T	A	10: 12,826,770		probably null	Het

Other mutations in Rev3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Rev3l	APN	10	39806969	missense	probably benign
IGL00815:Rev3l	APN	10	39859153	missense	possibly damaging	0.79
IGL00964:Rev3l	APN	10	39864806	missense	probably benign	0.39
IGL01765:Rev3l	APN	10	39828265	missense	probably benign	0.00
IGL01792:Rev3l	APN	10	39823340	missense	probably benign
IGL01950:Rev3l	APN	10	39821157	missense	probably damaging	1.00
IGL01963:Rev3l	APN	10	39822737	missense	possibly damaging	0.90
IGL02089:Rev3l	APN	10	39825099	missense	probably damaging	1.00
IGL02288:Rev3l	APN	10	39828216	missense	probably benign
IGL02381:Rev3l	APN	10	39821346	missense	possibly damaging	0.83
IGL02409:Rev3l	APN	10	39821148	missense	possibly damaging	0.75
IGL02434:Rev3l	APN	10	39822591	missense	probably damaging	1.00
IGL02570:Rev3l	APN	10	39848013	missense	possibly damaging	0.68
IGL02581:Rev3l	APN	10	39821281	missense	probably benign	0.10
IGL02654:Rev3l	APN	10	39862734	missense	probably damaging	1.00
IGL02720:Rev3l	APN	10	39822395	nonsense	probably null
IGL02746:Rev3l	APN	10	39824589	missense	probably damaging	0.99
IGL02829:Rev3l	APN	10	39825240	missense	probably damaging	1.00
IGL02961:Rev3l	APN	10	39827945	missense	possibly damaging	0.65
IGL02974:Rev3l	APN	10	39862747	nonsense	probably null
IGL03029:Rev3l	APN	10	39828486	missense	probably benign	0.34
IGL03153:Rev3l	APN	10	39806878	missense	probably damaging	1.00
IGL03172:Rev3l	APN	10	39824790	missense	probably benign	0.10
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0153:Rev3l	UTSW	10	39874128	nonsense	probably null
R0308:Rev3l	UTSW	10	39824894	missense	probably benign	0.09
R0355:Rev3l	UTSW	10	39817286	missense	probably damaging	1.00
R0513:Rev3l	UTSW	10	39828143	missense	probably benign	0.00
R0523:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R0559:Rev3l	UTSW	10	39824487	missense	probably damaging	1.00
R0761:Rev3l	UTSW	10	39874195	missense	probably benign	0.32
R1023:Rev3l	UTSW	10	39832639	missense	probably damaging	1.00
R1159:Rev3l	UTSW	10	39851925	nonsense	probably null
R1398:Rev3l	UTSW	10	39821583	missense	probably benign	0.05
R1478:Rev3l	UTSW	10	39783333	critical splice donor site	probably null
R1517:Rev3l	UTSW	10	39838443	missense	probably benign	0.34
R1527:Rev3l	UTSW	10	39822822	missense	probably damaging	1.00
R1635:Rev3l	UTSW	10	39806662	missense	probably damaging	0.98
R1695:Rev3l	UTSW	10	39824615	nonsense	probably null
R1695:Rev3l	UTSW	10	39824616	missense	probably damaging	0.97
R1782:Rev3l	UTSW	10	39799885	missense	probably benign
R1815:Rev3l	UTSW	10	39822871	missense	probably benign	0.41
R1818:Rev3l	UTSW	10	39828424	missense	probably benign	0.05
R2039:Rev3l	UTSW	10	39824444	missense	probably damaging	1.00
R2071:Rev3l	UTSW	10	39824353	missense	probably benign	0.17
R2101:Rev3l	UTSW	10	39828096	missense	probably benign	0.00
R2141:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R2883:Rev3l	UTSW	10	39825156	missense	probably damaging	1.00
R3787:Rev3l	UTSW	10	39846210	missense	probably damaging	0.97
R3910:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3912:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3913:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R4590:Rev3l	UTSW	10	39806933	missense	probably damaging	1.00
R4631:Rev3l	UTSW	10	39828416	missense	probably benign	0.44
R4633:Rev3l	UTSW	10	39846186	missense	probably damaging	1.00
R4707:Rev3l	UTSW	10	39823397	missense	probably damaging	0.99
R4724:Rev3l	UTSW	10	39846806	nonsense	probably null
R4810:Rev3l	UTSW	10	39823725	missense	probably benign	0.01
R4857:Rev3l	UTSW	10	39838459	missense	probably damaging	1.00
R4882:Rev3l	UTSW	10	39821460	missense	possibly damaging	0.89
R4928:Rev3l	UTSW	10	39823985	missense	probably benign	0.30
R4970:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R4977:Rev3l	UTSW	10	39823578	missense	possibly damaging	0.80
R5112:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R5261:Rev3l	UTSW	10	39846729	missense	probably damaging	1.00
R5419:Rev3l	UTSW	10	39824931	missense	possibly damaging	0.95
R5570:Rev3l	UTSW	10	39852075	critical splice donor site	probably null
R5628:Rev3l	UTSW	10	39822967	missense	probably damaging	0.98
R5689:Rev3l	UTSW	10	39794958	missense	probably damaging	1.00
R5781:Rev3l	UTSW	10	39823093	missense	probably benign	0.00
R5829:Rev3l	UTSW	10	39806906	missense	probably damaging	0.97
R5984:Rev3l	UTSW	10	39742689	intron	probably benign
R5990:Rev3l	UTSW	10	39823811	missense	probably benign	0.17
R6054:Rev3l	UTSW	10	39824150	missense	probably benign	0.01
R6171:Rev3l	UTSW	10	39862713	nonsense	probably null
R6220:Rev3l	UTSW	10	39822779	missense	probably damaging	1.00
R6520:Rev3l	UTSW	10	39822702	missense	probably benign	0.06
R6798:Rev3l	UTSW	10	39854763	missense	probably damaging	1.00
R6811:Rev3l	UTSW	10	39830921	nonsense	probably null
R6812:Rev3l	UTSW	10	39823548	missense	probably benign
R6904:Rev3l	UTSW	10	39821481	missense	probably benign
R6905:Rev3l	UTSW	10	39817327	missense	probably benign	0.18
R6938:Rev3l	UTSW	10	39862710	missense	probably damaging	1.00
R7124:Rev3l	UTSW	10	39822167	nonsense	probably null
R7286:Rev3l	UTSW	10	39823605	missense	probably damaging	0.99
R7385:Rev3l	UTSW	10	39823682	missense	probably benign	0.01
R7575:Rev3l	UTSW	10	39821445	missense	possibly damaging	0.56
R7596:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R7597:Rev3l	UTSW	10	39822884	missense	probably damaging	1.00
R7670:Rev3l	UTSW	10	39836722	missense	probably benign	0.01
R7804:Rev3l	UTSW	10	39823485	missense	probably benign	0.34
R7818:Rev3l	UTSW	10	39823902	missense	possibly damaging	0.54
R7874:Rev3l	UTSW	10	39822495	missense	possibly damaging	0.72
R7957:Rev3l	UTSW	10	39822495	missense	possibly damaging	0.72
R8059:Rev3l	UTSW	10	39843495	missense	probably damaging	1.00
X0022:Rev3l	UTSW	10	39828607	critical splice donor site	probably null
Z1088:Rev3l	UTSW	10	39824318	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- ACCGAAGTCTATATGCATGTGG -3'
(R):5'- CTGGCACTGAAACCTTATGTTAG -3'

Sequencing Primer
(F):5'- GGTGTGATTGAGGCATTTTATACAC -3'
(R):5'- GCACTGAAACCTTATGTTAGTAAATG -3'

Posted On

2019-05-13