Incidental Mutation 'R7037:Kank1'
ID546804
Institutional Source Beutler Lab
Gene Symbol Kank1
Ensembl Gene ENSMUSG00000032702
Gene NameKN motif and ankyrin repeat domains 1
SynonymsD330024H06Rik, Ankrd15, A930031B09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7037 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location25236975-25434496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25430341 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1233 (D1233G)
Ref Sequence ENSEMBL: ENSMUSP00000042177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]
Predicted Effect probably damaging
Transcript: ENSMUST00000049400
AA Change: D1233G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: D1233G

DomainStartEndE-ValueType
Pfam:KN_motif 30 68 3.3e-24 PFAM
low complexity region 88 105 N/A INTRINSIC
low complexity region 138 148 N/A INTRINSIC
coiled coil region 286 314 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
coiled coil region 362 395 N/A INTRINSIC
coiled coil region 451 494 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Blast:ANK 963 993 7e-10 BLAST
low complexity region 1010 1030 N/A INTRINSIC
low complexity region 1074 1095 N/A INTRINSIC
ANK 1169 1199 3.71e-4 SMART
ANK 1203 1236 2.27e1 SMART
ANK 1241 1270 1.33e-5 SMART
ANK 1274 1306 5.84e-2 SMART
ANK 1308 1336 4.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146647
SMART Domains Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702

DomainStartEndE-ValueType
Pfam:KN_motif 58 96 2e-25 PFAM
low complexity region 116 133 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
coiled coil region 314 342 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
internal_repeat_1 430 479 3.72e-5 PROSPERO
low complexity region 569 584 N/A INTRINSIC
internal_repeat_1 587 636 3.72e-5 PROSPERO
low complexity region 645 657 N/A INTRINSIC
Blast:ANK 991 1021 4e-10 BLAST
low complexity region 1038 1058 N/A INTRINSIC
low complexity region 1102 1123 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 A T 7: 119,768,043 N33I probably damaging Het
Ahnak2 A T 12: 112,774,278 V314D probably damaging Het
Arl14epl T G 18: 46,932,443 C92G probably benign Het
Atp6v1h T A 1: 5,149,992 M423K possibly damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2b C T 2: 59,933,670 probably null Het
Bicral T C 17: 46,824,634 H550R probably benign Het
C1rl A G 6: 124,508,639 Y323C probably damaging Het
Ccr9 T A 9: 123,779,971 H239Q possibly damaging Het
Cdh16 T A 8: 104,617,635 R91* probably null Het
Coro1c A G 5: 113,845,396 F357S possibly damaging Het
Cpsf4 G A 5: 145,176,129 R141Q possibly damaging Het
Cryzl2 G A 1: 157,470,748 V236I probably damaging Het
Cttnbp2 T C 6: 18,435,118 E247G probably damaging Het
Dbr1 T A 9: 99,576,568 probably null Het
Dclk1 T C 3: 55,463,048 S23P probably damaging Het
Diexf A C 1: 193,120,723 probably null Het
Dpyd A T 3: 118,899,289 I361F probably benign Het
Elac2 A G 11: 64,983,711 E218G probably benign Het
Eml4 T A 17: 83,425,327 D136E probably benign Het
Fam198a G T 9: 121,965,526 V249L possibly damaging Het
Fam71e2 G T 7: 4,758,585 probably benign Het
Foxred1 A T 9: 35,207,548 S223T probably benign Het
Gm11595 A G 11: 99,772,648 C69R unknown Het
Gm14124 G T 2: 150,266,456 V46F possibly damaging Het
Gna14 A T 19: 16,533,764 H59L Het
H2-Ab1 T A 17: 34,267,989 I239N probably damaging Het
Ints7 T C 1: 191,619,605 S809P probably benign Het
Itgb4 T A 11: 116,005,565 Y1379* probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lrrc66 A T 5: 73,607,161 D846E probably benign Het
Lyst A G 13: 13,616,666 H38R probably damaging Het
Mc3r T C 2: 172,249,634 F259L probably damaging Het
Med25 A G 7: 44,882,782 Y384H probably damaging Het
Met A T 6: 17,547,128 probably benign Het
Mmp16 T C 4: 18,116,148 V584A possibly damaging Het
Mpp5 T A 12: 78,797,199 I59N probably damaging Het
Mrgprb3 A G 7: 48,643,194 L203P probably damaging Het
Mus81 A G 19: 5,486,080 L185P probably damaging Het
Naaa A G 5: 92,277,075 V75A possibly damaging Het
Obscn T A 11: 59,043,929 T5292S probably damaging Het
Obscn T C 11: 59,052,604 S4801G probably damaging Het
Olfr703 T C 7: 106,845,336 S242P probably damaging Het
Otof T C 5: 30,381,538 D1112G probably benign Het
Pbx4 A G 8: 69,864,875 R170G probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Plce1 A T 19: 38,702,017 D715V probably damaging Het
Pms1 T C 1: 53,207,611 T311A possibly damaging Het
Popdc2 A G 16: 38,374,267 D350G probably damaging Het
Prex1 A G 2: 166,587,180 V661A probably benign Het
Ptbp2 A G 3: 119,751,908 Y130H probably damaging Het
Rev3l C T 10: 39,851,975 R2707W probably damaging Het
Rpl37 G A 15: 5,117,703 R75K probably null Het
Ryr3 T A 2: 112,949,130 R259* probably null Het
Scai A T 2: 39,190,621 S8T probably benign Het
Scn4a C A 11: 106,320,900 L1430F probably damaging Het
Sema5a A G 15: 32,686,847 K1035R probably damaging Het
Siah3 A G 14: 75,525,585 H92R probably benign Het
Smc4 G A 3: 69,018,195 V342I possibly damaging Het
Spata31d1a C T 13: 59,700,324 C1330Y possibly damaging Het
St18 C A 1: 6,803,036 H332N possibly damaging Het
Sycp1 T A 3: 102,898,934 E480D possibly damaging Het
Tex14 A T 11: 87,497,915 I323F probably damaging Het
Tm7sf2 A T 19: 6,064,077 probably null Het
Tmem241 G T 18: 12,113,406 H62Q probably benign Het
Tmem54 T A 4: 129,110,801 probably null Het
Tomm34 A G 2: 164,070,478 L39P probably damaging Het
Triml2 T A 8: 43,193,536 V354D probably damaging Het
Usp19 T C 9: 108,496,958 I738T possibly damaging Het
Utrn T A 10: 12,826,770 probably null Het
Other mutations in Kank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Kank1 APN 19 25411758 missense probably benign
IGL00435:Kank1 APN 19 25430236 missense probably benign 0.41
IGL01105:Kank1 APN 19 25424316 missense possibly damaging 0.80
IGL01974:Kank1 APN 19 25410232 missense possibly damaging 0.87
IGL02031:Kank1 APN 19 25410702 missense probably benign 0.01
IGL02125:Kank1 APN 19 25410703 missense possibly damaging 0.90
IGL02152:Kank1 APN 19 25428172 missense possibly damaging 0.51
IGL02211:Kank1 APN 19 25430338 missense probably damaging 1.00
IGL02440:Kank1 APN 19 25432908 missense probably damaging 1.00
IGL02448:Kank1 APN 19 25411375 missense probably damaging 1.00
IGL02671:Kank1 APN 19 25428095 missense probably damaging 1.00
IGL03102:Kank1 APN 19 25425918 missense probably damaging 1.00
IGL03259:Kank1 APN 19 25430341 missense probably damaging 1.00
IGL02802:Kank1 UTSW 19 25411599 missense probably damaging 1.00
R0107:Kank1 UTSW 19 25430366 unclassified probably benign
R0190:Kank1 UTSW 19 25409283 missense probably benign 0.00
R0330:Kank1 UTSW 19 25424313 missense probably benign 0.00
R0368:Kank1 UTSW 19 25410603 nonsense probably null
R0399:Kank1 UTSW 19 25411242 missense probably benign 0.00
R0426:Kank1 UTSW 19 25411473 missense probably damaging 1.00
R0483:Kank1 UTSW 19 25425993 unclassified probably benign
R1394:Kank1 UTSW 19 25428164 missense probably damaging 1.00
R1495:Kank1 UTSW 19 25410349 missense probably damaging 0.98
R1681:Kank1 UTSW 19 25410304 missense possibly damaging 0.89
R1698:Kank1 UTSW 19 25411317 missense probably benign 0.11
R1830:Kank1 UTSW 19 25411032 missense probably benign 0.00
R1866:Kank1 UTSW 19 25411449 missense probably benign 0.04
R2138:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2139:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2420:Kank1 UTSW 19 25410457 missense probably damaging 1.00
R3153:Kank1 UTSW 19 25410688 missense possibly damaging 0.89
R4164:Kank1 UTSW 19 25411072 missense probably benign 0.10
R4670:Kank1 UTSW 19 25410580 missense probably benign 0.00
R4685:Kank1 UTSW 19 25410034 missense possibly damaging 0.66
R4843:Kank1 UTSW 19 25431007 missense probably damaging 1.00
R4981:Kank1 UTSW 19 25411395 missense probably benign 0.19
R5189:Kank1 UTSW 19 25424181 missense probably damaging 1.00
R5280:Kank1 UTSW 19 25411305 missense probably benign 0.01
R5330:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5331:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5435:Kank1 UTSW 19 25411143 missense probably benign 0.04
R5500:Kank1 UTSW 19 25424332 missense possibly damaging 0.46
R5894:Kank1 UTSW 19 25424200 missense probably damaging 1.00
R6087:Kank1 UTSW 19 25409724 missense probably benign 0.41
R6357:Kank1 UTSW 19 25411353 missense probably benign 0.36
R6490:Kank1 UTSW 19 25410085 missense probably damaging 1.00
R6504:Kank1 UTSW 19 25428154 missense probably damaging 1.00
R6942:Kank1 UTSW 19 25424173 missense possibly damaging 0.88
R7405:Kank1 UTSW 19 25410319 nonsense probably null
R7486:Kank1 UTSW 19 25410829 missense probably damaging 0.99
R7602:Kank1 UTSW 19 25422161 missense probably benign 0.01
R7701:Kank1 UTSW 19 25411765 critical splice donor site probably null
R7765:Kank1 UTSW 19 25411205 frame shift probably null
R7766:Kank1 UTSW 19 25411205 frame shift probably null
R7768:Kank1 UTSW 19 25411205 frame shift probably null
R8020:Kank1 UTSW 19 25411205 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AACGCTAACGGTTCCGGATG -3'
(R):5'- CCTTGTGTGCAACCATGTTTAGTC -3'

Sequencing Primer
(F):5'- GGATGGCTCTCCCTAAAGAGATTTC -3'
(R):5'- CTGCAAGCTTCCTAGGCAAAGTAG -3'
Posted On2019-05-13