Incidental Mutation 'R7038:Ptpn18'
ID 546807
Institutional Source Beutler Lab
Gene Symbol Ptpn18
Ensembl Gene ENSMUSG00000026126
Gene Name protein tyrosine phosphatase, non-receptor type 18
Synonyms Ptpk1, PTP-HSCF, FLP1, HSCF, PTP-K1
MMRRC Submission 045138-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.156) question?
Stock # R7038 (G1)
Quality Score 218.009
Status Validated
Chromosome 1
Chromosomal Location 34498843-34514814 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) T to A at 34498906 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000027302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027302] [ENSMUST00000190122]
AlphaFold Q61152
Predicted Effect probably null
Transcript: ENSMUST00000027302
AA Change: M1K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027302
Gene: ENSMUSG00000026126
AA Change: M1K

DomainStartEndE-ValueType
PTPc 25 293 7.77e-115 SMART
Predicted Effect probably null
Transcript: ENSMUST00000190122
AA Change: M1K
SMART Domains Protein: ENSMUSP00000139885
Gene: ENSMUSG00000026126
AA Change: M1K

DomainStartEndE-ValueType
PTPc 2 269 9.1e-113 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, the mitotic cycle, and oncogenic transformation. This PTP contains a PEST motif, which often serves as a protein-protein interaction domain, and may be related to protein intracellular half-live. This protein can differentially dephosphorylate autophosphorylated tyrosine kinases that are overexpressed in tumor tissues, and it appears to regulate HER2, a member of the epidermal growth factor receptor family of receptor tyrosine kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,468,979 (GRCm39) S748P possibly damaging Het
Alppl2 T C 1: 87,016,833 (GRCm39) D104G probably damaging Het
Als2 C A 1: 59,206,673 (GRCm39) W1590L possibly damaging Het
Aopep G T 13: 63,338,339 (GRCm39) V571F possibly damaging Het
Aplf C T 6: 87,630,805 (GRCm39) W210* probably null Het
Ash1l A T 3: 88,889,978 (GRCm39) H619L probably benign Het
Baiap3 G A 17: 25,462,814 (GRCm39) R1075C probably benign Het
Bpifb1 G T 2: 154,044,589 (GRCm39) V19F probably damaging Het
Capn1 A T 19: 6,064,349 (GRCm39) L50Q probably benign Het
Carmil1 A G 13: 24,323,318 (GRCm39) S245P probably damaging Het
Cavin4 A G 4: 48,672,479 (GRCm39) H308R probably benign Het
Cd4 C T 6: 124,847,217 (GRCm39) V316M probably damaging Het
Cdcp1 T C 9: 123,002,662 (GRCm39) Y803C probably damaging Het
Cep295nl A G 11: 118,223,815 (GRCm39) I343T probably benign Het
Cgn T G 3: 94,670,392 (GRCm39) T1021P possibly damaging Het
Cilk1 C T 9: 78,016,484 (GRCm39) probably benign Het
Col6a5 A G 9: 105,822,937 (GRCm39) V140A unknown Het
Cops8 T C 1: 90,531,320 (GRCm39) probably benign Het
Crhbp A G 13: 95,580,699 (GRCm39) Y54H probably damaging Het
Cyp2c29 G A 19: 39,275,571 (GRCm39) V4I probably benign Het
Cyp2j6 T A 4: 96,423,708 (GRCm39) Y220F probably benign Het
D130043K22Rik A G 13: 25,077,391 (GRCm39) D1008G probably damaging Het
Ddx47 T A 6: 135,000,336 (GRCm39) V444E possibly damaging Het
Dnttip2 T A 3: 122,070,181 (GRCm39) C465* probably null Het
Dst C A 1: 34,221,879 (GRCm39) S2561* probably null Het
Dstyk T C 1: 132,381,847 (GRCm39) S534P probably benign Het
Eif4e A G 3: 138,232,943 (GRCm39) probably benign Het
Eipr1 C T 12: 28,801,817 (GRCm39) probably benign Het
Fastkd2 T A 1: 63,771,032 (GRCm39) D129E possibly damaging Het
Fndc3b C T 3: 27,555,618 (GRCm39) G312D probably benign Het
Gab2 T A 7: 96,952,290 (GRCm39) I562N probably damaging Het
Gata5 C A 2: 179,975,685 (GRCm39) D160Y possibly damaging Het
Gcn1 G A 5: 115,749,203 (GRCm39) V1912I probably damaging Het
Gdf5 C A 2: 155,786,655 (GRCm39) Q107H probably damaging Het
Gdpd1 A G 11: 86,926,118 (GRCm39) Y276H probably damaging Het
Gins1 A G 2: 150,759,791 (GRCm39) Y81C probably damaging Het
Gm28360 T C 1: 117,781,329 (GRCm39) C107R probably damaging Het
Hadha T C 5: 30,324,998 (GRCm39) probably null Het
Hcn4 A T 9: 58,730,867 (GRCm39) I25F unknown Het
Hectd4 A G 5: 121,437,660 (GRCm39) Y1095C possibly damaging Het
Hsp90b1 A T 10: 86,531,730 (GRCm39) L73Q probably damaging Het
Hspa12a A G 19: 58,793,132 (GRCm39) V351A probably damaging Het
Htr1b T A 9: 81,514,296 (GRCm39) M104L probably benign Het
Igf2r T C 17: 12,917,212 (GRCm39) T1563A probably benign Het
Kif13a C T 13: 46,905,931 (GRCm39) V671M possibly damaging Het
Liph A T 16: 21,795,009 (GRCm39) V201E probably damaging Het
Ltn1 T C 16: 87,221,759 (GRCm39) D196G probably damaging Het
Med15 C T 16: 17,470,591 (GRCm39) D589N possibly damaging Het
Mknk1 A G 4: 115,714,307 (GRCm39) D26G probably damaging Het
Mpi T C 9: 57,452,500 (GRCm39) D344G probably damaging Het
Mrc2 A G 11: 105,223,062 (GRCm39) E435G possibly damaging Het
Mrps5 A G 2: 127,442,786 (GRCm39) E285G probably damaging Het
Ms4a20 A T 19: 11,087,675 (GRCm39) F85L probably benign Het
Muc16 T A 9: 18,531,764 (GRCm39) M6197L probably damaging Het
Myo3b A T 2: 69,925,552 (GRCm39) E34D probably benign Het
Nsd3 T C 8: 26,131,279 (GRCm39) S215P probably damaging Het
Nsmce2 T A 15: 59,368,679 (GRCm39) probably benign Het
Ntan1 T C 16: 13,644,774 (GRCm39) S37P probably benign Het
Nup210l T A 3: 90,067,254 (GRCm39) Y765N probably damaging Het
Or10q12 A T 19: 13,745,715 (GRCm39) D3V probably benign Het
Or2aa1 T C 11: 59,480,408 (GRCm39) Y169C possibly damaging Het
Or4s2b A T 2: 88,509,085 (GRCm39) R288S probably damaging Het
Or7g30 A C 9: 19,352,888 (GRCm39) L226F possibly damaging Het
Pald1 T C 10: 61,175,078 (GRCm39) H724R probably benign Het
Pcdhb7 A T 18: 37,475,257 (GRCm39) D131V possibly damaging Het
Pds5b G T 5: 150,724,225 (GRCm39) R1269S probably benign Het
Pikfyve T C 1: 65,273,520 (GRCm39) V645A probably damaging Het
Plag1 G T 4: 3,904,676 (GRCm39) H172N probably damaging Het
Plch2 G C 4: 155,074,489 (GRCm39) probably null Het
Plxnb1 T A 9: 108,929,453 (GRCm39) V103E probably damaging Het
Prpf8 T A 11: 75,386,984 (GRCm39) M1143K probably benign Het
Rasgrf2 G A 13: 92,130,952 (GRCm39) T703I possibly damaging Het
Rassf6 A T 5: 90,757,584 (GRCm39) H125Q probably benign Het
Sdad1 A G 5: 92,446,049 (GRCm39) probably null Het
Sf3a3 T A 4: 124,622,219 (GRCm39) F426L probably benign Het
Sgsm3 T C 15: 80,892,576 (GRCm39) F6L possibly damaging Het
Slc14a2 A T 18: 78,202,252 (GRCm39) I626N probably damaging Het
Slc17a8 T C 10: 89,436,083 (GRCm39) N165S probably benign Het
Slc41a1 C A 1: 131,769,795 (GRCm39) A305D possibly damaging Het
Smyd4 C A 11: 75,281,340 (GRCm39) P271Q probably damaging Het
Spag17 C A 3: 99,891,925 (GRCm39) H260N probably benign Het
Spata2 A T 2: 167,327,283 (GRCm39) V38E possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,224,826 (GRCm39) probably benign Het
Syt14 T A 1: 192,665,966 (GRCm39) probably benign Het
Tbx21 A G 11: 96,990,597 (GRCm39) S329P probably damaging Het
Tex2 A T 11: 106,402,726 (GRCm39) probably null Het
Tmem62 A G 2: 120,824,058 (GRCm39) I244M possibly damaging Het
Tnks A T 8: 35,318,790 (GRCm39) N830K probably damaging Het
Tox2 A G 2: 163,156,264 (GRCm39) E145G probably damaging Het
Tpcn1 T C 5: 120,723,342 (GRCm39) D7G probably damaging Het
Ttc28 T A 5: 111,414,445 (GRCm39) M1320K probably benign Het
Tubgcp5 T G 7: 55,455,114 (GRCm39) V270G probably damaging Het
Unc5a A G 13: 55,152,297 (GRCm39) R62G probably damaging Het
Unc5d A G 8: 29,205,749 (GRCm39) probably null Het
Utrn T C 10: 12,558,082 (GRCm39) H1459R probably damaging Het
Vmn2r100 T A 17: 19,725,263 (GRCm39) L64Q possibly damaging Het
Wdr55 T G 18: 36,893,473 (GRCm39) L45R probably damaging Het
Zfp292 A G 4: 34,816,357 (GRCm39) Y306H probably damaging Het
Zfp398 G T 6: 47,843,243 (GRCm39) D300Y probably damaging Het
Zfp407 A G 18: 84,579,982 (GRCm39) V377A probably damaging Het
Zfp457 G A 13: 67,441,997 (GRCm39) H97Y probably benign Het
Zfp467 T C 6: 48,415,072 (GRCm39) T527A probably damaging Het
Other mutations in Ptpn18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Ptpn18 APN 1 34,502,200 (GRCm39) missense probably damaging 0.98
IGL01611:Ptpn18 APN 1 34,498,898 (GRCm39) utr 5 prime probably benign
IGL01633:Ptpn18 APN 1 34,510,989 (GRCm39) missense probably benign 0.03
IGL03379:Ptpn18 APN 1 34,509,338 (GRCm39) splice site probably null
R0848:Ptpn18 UTSW 1 34,501,783 (GRCm39) missense probably damaging 1.00
R1400:Ptpn18 UTSW 1 34,502,587 (GRCm39) critical splice donor site probably null
R1973:Ptpn18 UTSW 1 34,502,190 (GRCm39) missense probably damaging 1.00
R2040:Ptpn18 UTSW 1 34,509,300 (GRCm39) missense probably damaging 0.99
R2113:Ptpn18 UTSW 1 34,510,742 (GRCm39) missense probably damaging 1.00
R2963:Ptpn18 UTSW 1 34,510,773 (GRCm39) nonsense probably null
R4061:Ptpn18 UTSW 1 34,512,011 (GRCm39) missense possibly damaging 0.66
R4062:Ptpn18 UTSW 1 34,512,011 (GRCm39) missense possibly damaging 0.66
R4509:Ptpn18 UTSW 1 34,501,823 (GRCm39) missense possibly damaging 0.49
R4522:Ptpn18 UTSW 1 34,512,041 (GRCm39) missense probably benign
R4626:Ptpn18 UTSW 1 34,510,873 (GRCm39) splice site probably null
R4978:Ptpn18 UTSW 1 34,508,894 (GRCm39) intron probably benign
R5260:Ptpn18 UTSW 1 34,502,591 (GRCm39) splice site probably benign
R5335:Ptpn18 UTSW 1 34,502,259 (GRCm39) missense probably damaging 1.00
R5481:Ptpn18 UTSW 1 34,510,744 (GRCm39) missense possibly damaging 0.67
R5865:Ptpn18 UTSW 1 34,510,644 (GRCm39) splice site probably benign
R7225:Ptpn18 UTSW 1 34,511,927 (GRCm39) missense possibly damaging 0.58
R7290:Ptpn18 UTSW 1 34,501,892 (GRCm39) critical splice donor site probably null
R7411:Ptpn18 UTSW 1 34,511,273 (GRCm39) critical splice donor site probably null
R7434:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7441:Ptpn18 UTSW 1 34,512,416 (GRCm39) missense probably benign 0.00
R7442:Ptpn18 UTSW 1 34,501,831 (GRCm39) missense probably benign 0.02
R7462:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7463:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7464:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7465:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7535:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7537:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7678:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7689:Ptpn18 UTSW 1 34,512,445 (GRCm39) missense possibly damaging 0.75
R7899:Ptpn18 UTSW 1 34,508,986 (GRCm39) splice site probably null
R8543:Ptpn18 UTSW 1 34,511,229 (GRCm39) missense probably benign 0.00
R8821:Ptpn18 UTSW 1 34,511,271 (GRCm39) missense probably null 1.00
R8831:Ptpn18 UTSW 1 34,511,271 (GRCm39) missense probably null 1.00
R8858:Ptpn18 UTSW 1 34,502,196 (GRCm39) missense possibly damaging 0.88
R8879:Ptpn18 UTSW 1 34,502,211 (GRCm39) missense probably benign 0.23
R8924:Ptpn18 UTSW 1 34,498,966 (GRCm39) missense probably benign 0.02
R9657:Ptpn18 UTSW 1 34,512,473 (GRCm39) missense possibly damaging 0.87
X0065:Ptpn18 UTSW 1 34,508,972 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATTCCGCTGTCGCACGAC -3'
(R):5'- AACAGTAGCCGTCTTCACCC -3'

Sequencing Primer
(F):5'- AGCTACTTGGACGGCCAGTTC -3'
(R):5'- ACCTGTGGGCAAAGTGC -3'
Posted On 2019-05-13