Mutagenetix > Incidental Mutation

Incidental Mutation 'R7038:Pikfyve'

546810

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

MMRRC Submission

Accession Numbers

Genbank: NM_011086

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7038 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65234361 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 645 (V645A)

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000190058]

AlphaFold

Q9Z1T6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081154
AA Change: V600A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: V600A

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097707
AA Change: V645A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: V645A

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190058

SMART Domains

Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (101/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	T	19: 11,110,311	F85L	probably benign	Het
2010111I01Rik	G	T	13: 63,190,525	V571F	possibly damaging	Het
Abl2	T	C	1: 156,641,409	S748P	possibly damaging	Het
Alppl2	T	C	1: 87,089,111	D104G	probably damaging	Het
Als2	C	A	1: 59,167,514	W1590L	possibly damaging	Het
Aplf	C	T	6: 87,653,823	W210*	probably null	Het
Ash1l	A	T	3: 88,982,671	H619L	probably benign	Het
Baiap3	G	A	17: 25,243,840	R1075C	probably benign	Het
Bpifb1	G	T	2: 154,202,669	V19F	probably damaging	Het
Capn1	A	T	19: 6,014,319	L50Q	probably benign	Het
Carmil1	A	G	13: 24,139,335	S245P	probably damaging	Het
Cavin4	A	G	4: 48,672,479	H308R	probably benign	Het
Cd4	C	T	6: 124,870,254	V316M	probably damaging	Het
Cdcp1	T	C	9: 123,173,597	Y803C	probably damaging	Het
Cep295nl	A	G	11: 118,332,989	I343T	probably benign	Het
Cgn	T	G	3: 94,763,085	T1021P	possibly damaging	Het
Col6a5	A	G	9: 105,945,738	V140A	unknown	Het
Cops8	T	C	1: 90,603,598		probably benign	Het
Crhbp	A	G	13: 95,444,191	Y54H	probably damaging	Het
Cyp2c29	G	A	19: 39,287,127	V4I	probably benign	Het
Cyp2j6	T	A	4: 96,535,471	Y220F	probably benign	Het
D130043K22Rik	A	G	13: 24,893,408	D1008G	probably damaging	Het
Ddx47	T	A	6: 135,023,373	V444E	possibly damaging	Het
Dnttip2	T	A	3: 122,276,532	C465*	probably null	Het
Dst	C	A	1: 34,182,798	S2561*	probably null	Het
Dstyk	T	C	1: 132,454,109	S534P	probably benign	Het
Eif4e	A	G	3: 138,527,182		probably benign	Het
Eipr1	C	T	12: 28,751,818		probably benign	Het
Fastkd2	T	A	1: 63,731,873	D129E	possibly damaging	Het
Fndc3b	C	T	3: 27,501,469	G312D	probably benign	Het
Gab2	T	A	7: 97,303,083	I562N	probably damaging	Het
Gata5	C	A	2: 180,333,892	D160Y	possibly damaging	Het
Gcn1l1	G	A	5: 115,611,144	V1912I	probably damaging	Het
Gdf5	C	A	2: 155,944,735	Q107H	probably damaging	Het
Gdpd1	A	G	11: 87,035,292	Y276H	probably damaging	Het
Gins1	A	G	2: 150,917,871	Y81C	probably damaging	Het
Gm28360	T	C	1: 117,853,599	C107R	probably damaging	Het
Hadha	T	C	5: 30,120,000		probably null	Het
Hcn4	A	T	9: 58,823,584	I25F	unknown	Het
Hectd4	A	G	5: 121,299,597	Y1095C	possibly damaging	Het
Hsp90b1	A	T	10: 86,695,866	L73Q	probably damaging	Het
Hspa12a	A	G	19: 58,804,700	V351A	probably damaging	Het
Htr1b	T	A	9: 81,632,243	M104L	probably benign	Het
Ick	C	T	9: 78,109,202		probably benign	Het
Igf2r	T	C	17: 12,698,325	T1563A	probably benign	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Liph	A	T	16: 21,976,259	V201E	probably damaging	Het
Ltn1	T	C	16: 87,424,871	D196G	probably damaging	Het
Med15	C	T	16: 17,652,727	D589N	possibly damaging	Het
Mknk1	A	G	4: 115,857,110	D26G	probably damaging	Het
Mpi	T	C	9: 57,545,217	D344G	probably damaging	Het
Mrc2	A	G	11: 105,332,236	E435G	possibly damaging	Het
Mrps5	A	G	2: 127,600,866	E285G	probably damaging	Het
Muc16	T	A	9: 18,620,468	M6197L	probably damaging	Het
Myo3b	A	T	2: 70,095,208	E34D	probably benign	Het
Nsd3	T	C	8: 25,641,263	S215P	probably damaging	Het
Nsmce2	T	A	15: 59,496,830		probably benign	Het
Ntan1	T	C	16: 13,826,910	S37P	probably benign	Het
Nup210l	T	A	3: 90,159,947	Y765N	probably damaging	Het
Olfr1193	A	T	2: 88,678,741	R288S	probably damaging	Het
Olfr1495	A	T	19: 13,768,351	D3V	probably benign	Het
Olfr223	T	C	11: 59,589,582	Y169C	possibly damaging	Het
Olfr849	A	C	9: 19,441,592	L226F	possibly damaging	Het
Pald1	T	C	10: 61,339,299	H724R	probably benign	Het
Pcdhb7	A	T	18: 37,342,204	D131V	possibly damaging	Het
Pds5b	G	T	5: 150,800,760	R1269S	probably benign	Het
Plag1	G	T	4: 3,904,676	H172N	probably damaging	Het
Plch2	G	C	4: 154,990,032		probably null	Het
Plxnb1	T	A	9: 109,100,385	V103E	probably damaging	Het
Prpf8	T	A	11: 75,496,158	M1143K	probably benign	Het
Ptpn18	T	A	1: 34,459,825	M1K	probably null	Het
Rasgrf2	G	A	13: 91,982,833	T703I	possibly damaging	Het
Rassf6	A	T	5: 90,609,725	H125Q	probably benign	Het
Sdad1	A	G	5: 92,298,190		probably null	Het
Sf3a3	T	A	4: 124,728,426	F426L	probably benign	Het
Sgsm3	T	C	15: 81,008,375	F6L	possibly damaging	Het
Slc14a2	A	T	18: 78,159,037	I626N	probably damaging	Het
Slc17a8	T	C	10: 89,600,221	N165S	probably benign	Het
Slc41a1	C	A	1: 131,842,057	A305D	possibly damaging	Het
Smyd4	C	A	11: 75,390,514	P271Q	probably damaging	Het
Spag17	C	A	3: 99,984,609	H260N	probably benign	Het
Spata2	A	T	2: 167,485,363	V38E	possibly damaging	Het
Sprr2b	CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC	CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC	3: 92,317,519		probably benign	Het
Syt14	T	A	1: 192,983,658		probably benign	Het
Tbx21	A	G	11: 97,099,771	S329P	probably damaging	Het
Tex2	A	T	11: 106,511,900		probably null	Het
Tmem62	A	G	2: 120,993,577	I244M	possibly damaging	Het
Tnks	A	T	8: 34,851,636	N830K	probably damaging	Het
Tox2	A	G	2: 163,314,344	E145G	probably damaging	Het
Tpcn1	T	C	5: 120,585,277	D7G	probably damaging	Het
Ttc28	T	A	5: 111,266,579	M1320K	probably benign	Het
Tubgcp5	T	G	7: 55,805,366	V270G	probably damaging	Het
Unc5a	A	G	13: 55,004,484	R62G	probably damaging	Het
Unc5d	A	G	8: 28,715,721		probably null	Het
Utrn	T	C	10: 12,682,338	H1459R	probably damaging	Het
Vmn2r100	T	A	17: 19,505,001	L64Q	possibly damaging	Het
Wdr55	T	G	18: 36,760,420	L45R	probably damaging	Het
Zfp292	A	G	4: 34,816,357	Y306H	probably damaging	Het
Zfp398	G	T	6: 47,866,309	D300Y	probably damaging	Het
Zfp407	A	G	18: 84,561,857	V377A	probably damaging	Het
Zfp457	G	A	13: 67,293,933	H97Y	probably benign	Het
Zfp467	T	C	6: 48,438,138	T527A	probably damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65260121	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65251635	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65258869	nonsense	probably null
IGL01759:Pikfyve	APN	1	65253353	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65223640	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65264365	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65238544	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65272571	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65246397	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65251678	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65256021	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65252569	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65244504	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65251612	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65264376	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65230855	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65234272	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65250194	nonsense	probably null
IGL02890:Pikfyve	APN	1	65230797	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65252467	nonsense	probably null
IGL03294:Pikfyve	APN	1	65247067	missense	probably damaging	1.00
falcon	UTSW	1	65196741	missense	probably damaging	1.00
oompa	UTSW	1	65196706	missense	probably damaging	1.00
wonka	UTSW	1	65196706	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65202916	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65215929	splice site	probably benign
R0196:Pikfyve	UTSW	1	65256072	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65262905	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65246331	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65264399	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65219899	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65253523	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65253397	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65265824	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65246959	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65271311	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65224201	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65262977	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65265284	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65252548	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65192271	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65246370	missense	probably benign
R1795:Pikfyve	UTSW	1	65252557	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65258798	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65192295	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65246708	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65222357	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65253353	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65267855	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65246676	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65253517	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65245758	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65244420	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65230845	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65196681	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65190520	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65244430	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65192192	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65234262	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65267846	missense	probably benign
R4716:Pikfyve	UTSW	1	65246476	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65272515	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65267846	missense	probably benign
R4785:Pikfyve	UTSW	1	65267846	missense	probably benign
R4805:Pikfyve	UTSW	1	65268800	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65196741	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65246590	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65224117	intron	probably benign
R5265:Pikfyve	UTSW	1	65267829	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65196699	nonsense	probably null
R5384:Pikfyve	UTSW	1	65244409	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65265268	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65235033	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65252495	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65273730	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65256088	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65216028	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65202737	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65253438	nonsense	probably null
R6026:Pikfyve	UTSW	1	65272697	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65272571	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65216043	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65253532	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65202925	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65262953	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65265781	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65258843	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65252530	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65246663	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65246854	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65247205	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65244426	nonsense	probably null
R7558:Pikfyve	UTSW	1	65272623	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65267877	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65269942	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65265789	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65246395	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65253342	splice site	probably benign
R8307:Pikfyve	UTSW	1	65245735	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65215996	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65244417	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65271268	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65246970	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65205587	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65244400	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65246080	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65196739	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65260029	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65268742	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65264402	missense	probably benign
R9605:Pikfyve	UTSW	1	65264402	missense	probably benign
R9686:Pikfyve	UTSW	1	65252456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGCACTTTGAAGGTCATTTG -3'
(R):5'- GCTCTATTTGTATTGTTGACAGAGC -3'

Sequencing Primer
(F):5'- TTGAAGGTCATTTGTTAGTTTAAAGC -3'
(R):5'- GCAGACAAGTTTATGGTAATCCTCC -3'

Posted On

2019-05-13