Incidental Mutation 'R7038:Myo3b'
ID 546818
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 045138-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7038 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69925552 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 34 (E34D)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112241] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: E34D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: E34D

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112241
SMART Domains Protein: ENSMUSP00000107860
Gene: ENSMUSG00000042064

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 187 3.7e-30 PFAM
Pfam:Pkinase 1 188 8.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: E6D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: E6D

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,468,979 (GRCm39) S748P possibly damaging Het
Alppl2 T C 1: 87,016,833 (GRCm39) D104G probably damaging Het
Als2 C A 1: 59,206,673 (GRCm39) W1590L possibly damaging Het
Aopep G T 13: 63,338,339 (GRCm39) V571F possibly damaging Het
Aplf C T 6: 87,630,805 (GRCm39) W210* probably null Het
Ash1l A T 3: 88,889,978 (GRCm39) H619L probably benign Het
Baiap3 G A 17: 25,462,814 (GRCm39) R1075C probably benign Het
Bpifb1 G T 2: 154,044,589 (GRCm39) V19F probably damaging Het
Capn1 A T 19: 6,064,349 (GRCm39) L50Q probably benign Het
Carmil1 A G 13: 24,323,318 (GRCm39) S245P probably damaging Het
Cavin4 A G 4: 48,672,479 (GRCm39) H308R probably benign Het
Cd4 C T 6: 124,847,217 (GRCm39) V316M probably damaging Het
Cdcp1 T C 9: 123,002,662 (GRCm39) Y803C probably damaging Het
Cep295nl A G 11: 118,223,815 (GRCm39) I343T probably benign Het
Cgn T G 3: 94,670,392 (GRCm39) T1021P possibly damaging Het
Cilk1 C T 9: 78,016,484 (GRCm39) probably benign Het
Col6a5 A G 9: 105,822,937 (GRCm39) V140A unknown Het
Cops8 T C 1: 90,531,320 (GRCm39) probably benign Het
Crhbp A G 13: 95,580,699 (GRCm39) Y54H probably damaging Het
Cyp2c29 G A 19: 39,275,571 (GRCm39) V4I probably benign Het
Cyp2j6 T A 4: 96,423,708 (GRCm39) Y220F probably benign Het
D130043K22Rik A G 13: 25,077,391 (GRCm39) D1008G probably damaging Het
Ddx47 T A 6: 135,000,336 (GRCm39) V444E possibly damaging Het
Dnttip2 T A 3: 122,070,181 (GRCm39) C465* probably null Het
Dst C A 1: 34,221,879 (GRCm39) S2561* probably null Het
Dstyk T C 1: 132,381,847 (GRCm39) S534P probably benign Het
Eif4e A G 3: 138,232,943 (GRCm39) probably benign Het
Eipr1 C T 12: 28,801,817 (GRCm39) probably benign Het
Fastkd2 T A 1: 63,771,032 (GRCm39) D129E possibly damaging Het
Fndc3b C T 3: 27,555,618 (GRCm39) G312D probably benign Het
Gab2 T A 7: 96,952,290 (GRCm39) I562N probably damaging Het
Gata5 C A 2: 179,975,685 (GRCm39) D160Y possibly damaging Het
Gcn1 G A 5: 115,749,203 (GRCm39) V1912I probably damaging Het
Gdf5 C A 2: 155,786,655 (GRCm39) Q107H probably damaging Het
Gdpd1 A G 11: 86,926,118 (GRCm39) Y276H probably damaging Het
Gins1 A G 2: 150,759,791 (GRCm39) Y81C probably damaging Het
Gm28360 T C 1: 117,781,329 (GRCm39) C107R probably damaging Het
Hadha T C 5: 30,324,998 (GRCm39) probably null Het
Hcn4 A T 9: 58,730,867 (GRCm39) I25F unknown Het
Hectd4 A G 5: 121,437,660 (GRCm39) Y1095C possibly damaging Het
Hsp90b1 A T 10: 86,531,730 (GRCm39) L73Q probably damaging Het
Hspa12a A G 19: 58,793,132 (GRCm39) V351A probably damaging Het
Htr1b T A 9: 81,514,296 (GRCm39) M104L probably benign Het
Igf2r T C 17: 12,917,212 (GRCm39) T1563A probably benign Het
Kif13a C T 13: 46,905,931 (GRCm39) V671M possibly damaging Het
Liph A T 16: 21,795,009 (GRCm39) V201E probably damaging Het
Ltn1 T C 16: 87,221,759 (GRCm39) D196G probably damaging Het
Med15 C T 16: 17,470,591 (GRCm39) D589N possibly damaging Het
Mknk1 A G 4: 115,714,307 (GRCm39) D26G probably damaging Het
Mpi T C 9: 57,452,500 (GRCm39) D344G probably damaging Het
Mrc2 A G 11: 105,223,062 (GRCm39) E435G possibly damaging Het
Mrps5 A G 2: 127,442,786 (GRCm39) E285G probably damaging Het
Ms4a20 A T 19: 11,087,675 (GRCm39) F85L probably benign Het
Muc16 T A 9: 18,531,764 (GRCm39) M6197L probably damaging Het
Nsd3 T C 8: 26,131,279 (GRCm39) S215P probably damaging Het
Nsmce2 T A 15: 59,368,679 (GRCm39) probably benign Het
Ntan1 T C 16: 13,644,774 (GRCm39) S37P probably benign Het
Nup210l T A 3: 90,067,254 (GRCm39) Y765N probably damaging Het
Or10q12 A T 19: 13,745,715 (GRCm39) D3V probably benign Het
Or2aa1 T C 11: 59,480,408 (GRCm39) Y169C possibly damaging Het
Or4s2b A T 2: 88,509,085 (GRCm39) R288S probably damaging Het
Or7g30 A C 9: 19,352,888 (GRCm39) L226F possibly damaging Het
Pald1 T C 10: 61,175,078 (GRCm39) H724R probably benign Het
Pcdhb7 A T 18: 37,475,257 (GRCm39) D131V possibly damaging Het
Pds5b G T 5: 150,724,225 (GRCm39) R1269S probably benign Het
Pikfyve T C 1: 65,273,520 (GRCm39) V645A probably damaging Het
Plag1 G T 4: 3,904,676 (GRCm39) H172N probably damaging Het
Plch2 G C 4: 155,074,489 (GRCm39) probably null Het
Plxnb1 T A 9: 108,929,453 (GRCm39) V103E probably damaging Het
Prpf8 T A 11: 75,386,984 (GRCm39) M1143K probably benign Het
Ptpn18 T A 1: 34,498,906 (GRCm39) M1K probably null Het
Rasgrf2 G A 13: 92,130,952 (GRCm39) T703I possibly damaging Het
Rassf6 A T 5: 90,757,584 (GRCm39) H125Q probably benign Het
Sdad1 A G 5: 92,446,049 (GRCm39) probably null Het
Sf3a3 T A 4: 124,622,219 (GRCm39) F426L probably benign Het
Sgsm3 T C 15: 80,892,576 (GRCm39) F6L possibly damaging Het
Slc14a2 A T 18: 78,202,252 (GRCm39) I626N probably damaging Het
Slc17a8 T C 10: 89,436,083 (GRCm39) N165S probably benign Het
Slc41a1 C A 1: 131,769,795 (GRCm39) A305D possibly damaging Het
Smyd4 C A 11: 75,281,340 (GRCm39) P271Q probably damaging Het
Spag17 C A 3: 99,891,925 (GRCm39) H260N probably benign Het
Spata2 A T 2: 167,327,283 (GRCm39) V38E possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,224,826 (GRCm39) probably benign Het
Syt14 T A 1: 192,665,966 (GRCm39) probably benign Het
Tbx21 A G 11: 96,990,597 (GRCm39) S329P probably damaging Het
Tex2 A T 11: 106,402,726 (GRCm39) probably null Het
Tmem62 A G 2: 120,824,058 (GRCm39) I244M possibly damaging Het
Tnks A T 8: 35,318,790 (GRCm39) N830K probably damaging Het
Tox2 A G 2: 163,156,264 (GRCm39) E145G probably damaging Het
Tpcn1 T C 5: 120,723,342 (GRCm39) D7G probably damaging Het
Ttc28 T A 5: 111,414,445 (GRCm39) M1320K probably benign Het
Tubgcp5 T G 7: 55,455,114 (GRCm39) V270G probably damaging Het
Unc5a A G 13: 55,152,297 (GRCm39) R62G probably damaging Het
Unc5d A G 8: 29,205,749 (GRCm39) probably null Het
Utrn T C 10: 12,558,082 (GRCm39) H1459R probably damaging Het
Vmn2r100 T A 17: 19,725,263 (GRCm39) L64Q possibly damaging Het
Wdr55 T G 18: 36,893,473 (GRCm39) L45R probably damaging Het
Zfp292 A G 4: 34,816,357 (GRCm39) Y306H probably damaging Het
Zfp398 G T 6: 47,843,243 (GRCm39) D300Y probably damaging Het
Zfp407 A G 18: 84,579,982 (GRCm39) V377A probably damaging Het
Zfp457 G A 13: 67,441,997 (GRCm39) H97Y probably benign Het
Zfp467 T C 6: 48,415,072 (GRCm39) T527A probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers
Posted On 2019-05-13