Mutagenetix > Incidental Mutation

Incidental Mutation 'R7038:Muc16'

546859

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

045138-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R7038 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 18620468 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 6197 (M6197L)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000208663]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000208663
AA Change: M6197L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Meta Mutation Damage Score

0.1339

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (101/102)

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	T	19: 11,110,311	F85L	probably benign	Het
2010111I01Rik	G	T	13: 63,190,525	V571F	possibly damaging	Het
Abl2	T	C	1: 156,641,409	S748P	possibly damaging	Het
Alppl2	T	C	1: 87,089,111	D104G	probably damaging	Het
Als2	C	A	1: 59,167,514	W1590L	possibly damaging	Het
Aplf	C	T	6: 87,653,823	W210*	probably null	Het
Ash1l	A	T	3: 88,982,671	H619L	probably benign	Het
Baiap3	G	A	17: 25,243,840	R1075C	probably benign	Het
Bpifb1	G	T	2: 154,202,669	V19F	probably damaging	Het
Capn1	A	T	19: 6,014,319	L50Q	probably benign	Het
Carmil1	A	G	13: 24,139,335	S245P	probably damaging	Het
Cavin4	A	G	4: 48,672,479	H308R	probably benign	Het
Cd4	C	T	6: 124,870,254	V316M	probably damaging	Het
Cdcp1	T	C	9: 123,173,597	Y803C	probably damaging	Het
Cep295nl	A	G	11: 118,332,989	I343T	probably benign	Het
Cgn	T	G	3: 94,763,085	T1021P	possibly damaging	Het
Col6a5	A	G	9: 105,945,738	V140A	unknown	Het
Cops8	T	C	1: 90,603,598		probably benign	Het
Crhbp	A	G	13: 95,444,191	Y54H	probably damaging	Het
Cyp2c29	G	A	19: 39,287,127	V4I	probably benign	Het
Cyp2j6	T	A	4: 96,535,471	Y220F	probably benign	Het
D130043K22Rik	A	G	13: 24,893,408	D1008G	probably damaging	Het
Ddx47	T	A	6: 135,023,373	V444E	possibly damaging	Het
Dnttip2	T	A	3: 122,276,532	C465*	probably null	Het
Dst	C	A	1: 34,182,798	S2561*	probably null	Het
Dstyk	T	C	1: 132,454,109	S534P	probably benign	Het
Eif4e	A	G	3: 138,527,182		probably benign	Het
Eipr1	C	T	12: 28,751,818		probably benign	Het
Fastkd2	T	A	1: 63,731,873	D129E	possibly damaging	Het
Fndc3b	C	T	3: 27,501,469	G312D	probably benign	Het
Gab2	T	A	7: 97,303,083	I562N	probably damaging	Het
Gata5	C	A	2: 180,333,892	D160Y	possibly damaging	Het
Gcn1l1	G	A	5: 115,611,144	V1912I	probably damaging	Het
Gdf5	C	A	2: 155,944,735	Q107H	probably damaging	Het
Gdpd1	A	G	11: 87,035,292	Y276H	probably damaging	Het
Gins1	A	G	2: 150,917,871	Y81C	probably damaging	Het
Gm28360	T	C	1: 117,853,599	C107R	probably damaging	Het
Hadha	T	C	5: 30,120,000		probably null	Het
Hcn4	A	T	9: 58,823,584	I25F	unknown	Het
Hectd4	A	G	5: 121,299,597	Y1095C	possibly damaging	Het
Hsp90b1	A	T	10: 86,695,866	L73Q	probably damaging	Het
Hspa12a	A	G	19: 58,804,700	V351A	probably damaging	Het
Htr1b	T	A	9: 81,632,243	M104L	probably benign	Het
Ick	C	T	9: 78,109,202		probably benign	Het
Igf2r	T	C	17: 12,698,325	T1563A	probably benign	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Liph	A	T	16: 21,976,259	V201E	probably damaging	Het
Ltn1	T	C	16: 87,424,871	D196G	probably damaging	Het
Med15	C	T	16: 17,652,727	D589N	possibly damaging	Het
Mknk1	A	G	4: 115,857,110	D26G	probably damaging	Het
Mpi	T	C	9: 57,545,217	D344G	probably damaging	Het
Mrc2	A	G	11: 105,332,236	E435G	possibly damaging	Het
Mrps5	A	G	2: 127,600,866	E285G	probably damaging	Het
Myo3b	A	T	2: 70,095,208	E34D	probably benign	Het
Nsd3	T	C	8: 25,641,263	S215P	probably damaging	Het
Nsmce2	T	A	15: 59,496,830		probably benign	Het
Ntan1	T	C	16: 13,826,910	S37P	probably benign	Het
Nup210l	T	A	3: 90,159,947	Y765N	probably damaging	Het
Olfr1193	A	T	2: 88,678,741	R288S	probably damaging	Het
Olfr1495	A	T	19: 13,768,351	D3V	probably benign	Het
Olfr223	T	C	11: 59,589,582	Y169C	possibly damaging	Het
Olfr849	A	C	9: 19,441,592	L226F	possibly damaging	Het
Pald1	T	C	10: 61,339,299	H724R	probably benign	Het
Pcdhb7	A	T	18: 37,342,204	D131V	possibly damaging	Het
Pds5b	G	T	5: 150,800,760	R1269S	probably benign	Het
Pikfyve	T	C	1: 65,234,361	V645A	probably damaging	Het
Plag1	G	T	4: 3,904,676	H172N	probably damaging	Het
Plch2	G	C	4: 154,990,032		probably null	Het
Plxnb1	T	A	9: 109,100,385	V103E	probably damaging	Het
Prpf8	T	A	11: 75,496,158	M1143K	probably benign	Het
Ptpn18	T	A	1: 34,459,825	M1K	probably null	Het
Rasgrf2	G	A	13: 91,982,833	T703I	possibly damaging	Het
Rassf6	A	T	5: 90,609,725	H125Q	probably benign	Het
Sdad1	A	G	5: 92,298,190		probably null	Het
Sf3a3	T	A	4: 124,728,426	F426L	probably benign	Het
Sgsm3	T	C	15: 81,008,375	F6L	possibly damaging	Het
Slc14a2	A	T	18: 78,159,037	I626N	probably damaging	Het
Slc17a8	T	C	10: 89,600,221	N165S	probably benign	Het
Slc41a1	C	A	1: 131,842,057	A305D	possibly damaging	Het
Smyd4	C	A	11: 75,390,514	P271Q	probably damaging	Het
Spag17	C	A	3: 99,984,609	H260N	probably benign	Het
Spata2	A	T	2: 167,485,363	V38E	possibly damaging	Het
Sprr2b	CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC	CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC	3: 92,317,519		probably benign	Het
Syt14	T	A	1: 192,983,658		probably benign	Het
Tbx21	A	G	11: 97,099,771	S329P	probably damaging	Het
Tex2	A	T	11: 106,511,900		probably null	Het
Tmem62	A	G	2: 120,993,577	I244M	possibly damaging	Het
Tnks	A	T	8: 34,851,636	N830K	probably damaging	Het
Tox2	A	G	2: 163,314,344	E145G	probably damaging	Het
Tpcn1	T	C	5: 120,585,277	D7G	probably damaging	Het
Ttc28	T	A	5: 111,266,579	M1320K	probably benign	Het
Tubgcp5	T	G	7: 55,805,366	V270G	probably damaging	Het
Unc5a	A	G	13: 55,004,484	R62G	probably damaging	Het
Unc5d	A	G	8: 28,715,721		probably null	Het
Utrn	T	C	10: 12,682,338	H1459R	probably damaging	Het
Vmn2r100	T	A	17: 19,505,001	L64Q	possibly damaging	Het
Wdr55	T	G	18: 36,760,420	L45R	probably damaging	Het
Zfp292	A	G	4: 34,816,357	Y306H	probably damaging	Het
Zfp398	G	T	6: 47,866,309	D300Y	probably damaging	Het
Zfp407	A	G	18: 84,561,857	V377A	probably damaging	Het
Zfp457	G	A	13: 67,293,933	H97Y	probably benign	Het
Zfp467	T	C	6: 48,438,138	T527A	probably damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
Brimming	UTSW	9	18592680	missense	probably damaging	0.99
R7038_muc16_859	UTSW	9	18620468	missense	probably damaging	0.99
Runneymeade	UTSW	9	18579317	critical splice donor site	probably null
slimey	UTSW	9	18590698	missense	probably damaging	1.00
viscous	UTSW	9	18644732	missense	unknown
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	splice site	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	splice site	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7921:Muc16	UTSW	9	18659318	missense	unknown
R7922:Muc16	UTSW	9	18584825	missense	probably benign	0.16
R7948:Muc16	UTSW	9	18642490	missense	unknown
R7957:Muc16	UTSW	9	18643471	missense	unknown
R7972:Muc16	UTSW	9	18645764	nonsense	probably null
R7992:Muc16	UTSW	9	18656429	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	probably benign	0.04
R8014:Muc16	UTSW	9	18654875	missense	unknown
R8033:Muc16	UTSW	9	18636606	missense	probably benign	0.26
R8052:Muc16	UTSW	9	18659051	missense	unknown
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
R8088:Muc16	UTSW	9	18519300	nonsense	probably null
R8095:Muc16	UTSW	9	18584830	nonsense	probably null
R8111:Muc16	UTSW	9	18592629	missense	possibly damaging	0.55
R8116:Muc16	UTSW	9	18658737	missense	unknown
R8117:Muc16	UTSW	9	18508910	nonsense	probably null
R8137:Muc16	UTSW	9	18645676	missense	unknown
R8196:Muc16	UTSW	9	18645334	missense	unknown
R8218:Muc16	UTSW	9	18637019	missense	possibly damaging	0.48
R8285:Muc16	UTSW	9	18642977	missense	unknown
R8313:Muc16	UTSW	9	18525147	missense	possibly damaging	0.85
R8317:Muc16	UTSW	9	18658043	missense	unknown
R8342:Muc16	UTSW	9	18658685	missense	unknown
R8351:Muc16	UTSW	9	18659885	missense	unknown
R8356:Muc16	UTSW	9	18658778	missense	unknown
R8360:Muc16	UTSW	9	18525258	missense	probably benign	0.01
R8418:Muc16	UTSW	9	18519630	missense	possibly damaging	0.94
R8420:Muc16	UTSW	9	18537511	missense	probably damaging	0.99
R8437:Muc16	UTSW	9	18657924	missense	unknown
R8463:Muc16	UTSW	9	18659139	missense	unknown
R8466:Muc16	UTSW	9	18643148	missense	unknown
R8512:Muc16	UTSW	9	18638192	missense	probably benign	0.01
R8518:Muc16	UTSW	9	18519631	missense	probably benign	0.12
R8556:Muc16	UTSW	9	18640937	missense	probably benign	0.01
R8679:Muc16	UTSW	9	18646448	missense	unknown
R8680:Muc16	UTSW	9	18644719	missense	unknown
R8720:Muc16	UTSW	9	18641600	missense	probably benign	0.01
R8729:Muc16	UTSW	9	18660050	missense	unknown
R8736:Muc16	UTSW	9	18550843	nonsense	probably null
R8739:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R8807:Muc16	UTSW	9	18656057	missense	unknown
R8830:Muc16	UTSW	9	18646069	missense	unknown
R8871:Muc16	UTSW	9	18656048	missense	unknown
R8884:Muc16	UTSW	9	18644200	missense	unknown
R8923:Muc16	UTSW	9	18638676	missense	probably benign	0.01
R8948:Muc16	UTSW	9	18647233	missense	unknown
R8949:Muc16	UTSW	9	18520925	critical splice donor site	probably null
R8987:Muc16	UTSW	9	18551685	nonsense	probably null
R8997:Muc16	UTSW	9	18607467	intron	probably benign
R9013:Muc16	UTSW	9	18512773	missense	possibly damaging	0.94
R9020:Muc16	UTSW	9	18638719	small insertion	probably benign
R9036:Muc16	UTSW	9	18644679	missense	unknown
R9040:Muc16	UTSW	9	18644786	nonsense	probably null
R9065:Muc16	UTSW	9	18643009	missense	unknown
R9089:Muc16	UTSW	9	18644550	missense	unknown
R9098:Muc16	UTSW	9	18643679	missense	unknown
R9100:Muc16	UTSW	9	18645670	missense	unknown
R9128:Muc16	UTSW	9	18647582	missense	unknown
R9169:Muc16	UTSW	9	18656528	missense	unknown
R9180:Muc16	UTSW	9	18642742	missense	unknown
R9191:Muc16	UTSW	9	18644810	missense	unknown
R9203:Muc16	UTSW	9	18551688	missense	unknown
R9208:Muc16	UTSW	9	18508537	missense	probably damaging	0.99
R9232:Muc16	UTSW	9	18656040	missense	unknown
R9240:Muc16	UTSW	9	18538013	missense	unknown
R9254:Muc16	UTSW	9	18646171	missense	unknown
R9330:Muc16	UTSW	9	18641036	missense	probably benign	0.04
R9347:Muc16	UTSW	9	18660215	missense	unknown
R9358:Muc16	UTSW	9	18642224	missense	probably benign	0.01
R9359:Muc16	UTSW	9	18537764	critical splice donor site	probably null
R9379:Muc16	UTSW	9	18646171	missense	unknown
R9403:Muc16	UTSW	9	18537764	critical splice donor site	probably null
R9422:Muc16	UTSW	9	18641806	missense	probably benign	0.01
R9433:Muc16	UTSW	9	18572641	missense	probably benign	0.09
R9438:Muc16	UTSW	9	18647732	missense	unknown
R9442:Muc16	UTSW	9	18655328	missense	unknown
R9453:Muc16	UTSW	9	18660765	missense	unknown
R9467:Muc16	UTSW	9	18597035	missense	probably benign	0.03
R9490:Muc16	UTSW	9	18656853	nonsense	probably null
R9519:Muc16	UTSW	9	18586920	missense	probably benign	0.03
R9524:Muc16	UTSW	9	18586018	missense	probably benign	0.03
R9556:Muc16	UTSW	9	18658638	missense	unknown
R9583:Muc16	UTSW	9	18638677	missense	probably benign	0.01
R9600:Muc16	UTSW	9	18655851	missense	unknown
R9638:Muc16	UTSW	9	18639330	missense	probably benign	0.12
R9650:Muc16	UTSW	9	18642466	missense	unknown
R9652:Muc16	UTSW	9	18586882	missense	probably benign	0.03
R9666:Muc16	UTSW	9	18655989	missense	unknown
R9682:Muc16	UTSW	9	18642578	missense	unknown
R9765:Muc16	UTSW	9	18637198	missense	probably benign	0.16
R9766:Muc16	UTSW	9	18636857	missense	probably benign	0.08
R9766:Muc16	UTSW	9	18641087	missense	probably benign	0.01
R9776:Muc16	UTSW	9	18659379	missense	unknown
R9782:Muc16	UTSW	9	18636770	missense	possibly damaging	0.64
Z1177:Muc16	UTSW	9	18537571	missense	probably benign	0.26
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGCAACCAGAATAAAGATGTCC -3'
(R):5'- ACCGATGCTGTTATATGCATTG -3'

Sequencing Primer
(F):5'- CCAATACTGCTATTCTTGAACATGGG -3'
(R):5'- GCTGTTATATGCATTGTCCAAGCAG -3'

Posted On

2019-05-13