Mutagenetix > Incidental Mutation

Incidental Mutation 'R7038:Prpf8'

546873

Institutional Source

Beutler Lab

Gene Symbol

Prpf8

Ensembl Gene

ENSMUSG00000020850

Gene Name

pre-mRNA processing factor 8

Synonyms

Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R7038 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75486816-75509449 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75496158 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1143 (M1143K)

Ref Sequence

ENSEMBL: ENSMUSP00000099568 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]

AlphaFold

Q99PV0

Predicted Effect

probably benign
Transcript: ENSMUST00000018449
AA Change: M1143K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: M1143K

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-84	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	393	801	3.6e-226	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1079	7.1e-49	PFAM
Pfam:U5_2-snRNA_bdg	1208	1343	1.9e-73	PFAM
Pfam:U6-snRNA_bdg	1442	1601	3.7e-97	PFAM
Pfam:PRP8_domainIV	1760	1990	1.5e-132	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102510
AA Change: M1143K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: M1143K

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-90	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	395	801	2.9e-239	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1077	1.5e-51	PFAM
Pfam:U5_2-snRNA_bdg	1210	1343	1.1e-77	PFAM
Pfam:U6-snRNA_bdg	1442	1600	4.2e-97	PFAM
Pfam:PRP8_domainIV	1760	1989	9.8e-134	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000131283

SMART Domains

Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	92	1.9e-13	PFAM
Pfam:PRO8NT	90	154	2.5e-30	PFAM
low complexity region	314	333	N/A	INTRINSIC
Pfam:PROCN	338	746	1.7e-226	PFAM
low complexity region	747	759	N/A	INTRINSIC
Pfam:RRM_4	931	1024	5.3e-49	PFAM

Meta Mutation Damage Score

0.8256

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

99% (101/102)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	A	T	19: 11,110,311	F85L	probably benign	Het
2010111I01Rik	G	T	13: 63,190,525	V571F	possibly damaging	Het
Abl2	T	C	1: 156,641,409	S748P	possibly damaging	Het
Alppl2	T	C	1: 87,089,111	D104G	probably damaging	Het
Als2	C	A	1: 59,167,514	W1590L	possibly damaging	Het
Aplf	C	T	6: 87,653,823	W210*	probably null	Het
Ash1l	A	T	3: 88,982,671	H619L	probably benign	Het
Baiap3	G	A	17: 25,243,840	R1075C	probably benign	Het
Bpifb1	G	T	2: 154,202,669	V19F	probably damaging	Het
Capn1	A	T	19: 6,014,319	L50Q	probably benign	Het
Carmil1	A	G	13: 24,139,335	S245P	probably damaging	Het
Cavin4	A	G	4: 48,672,479	H308R	probably benign	Het
Cd4	C	T	6: 124,870,254	V316M	probably damaging	Het
Cdcp1	T	C	9: 123,173,597	Y803C	probably damaging	Het
Cep295nl	A	G	11: 118,332,989	I343T	probably benign	Het
Cgn	T	G	3: 94,763,085	T1021P	possibly damaging	Het
Col6a5	A	G	9: 105,945,738	V140A	unknown	Het
Cops8	T	C	1: 90,603,598		probably benign	Het
Crhbp	A	G	13: 95,444,191	Y54H	probably damaging	Het
Cyp2c29	G	A	19: 39,287,127	V4I	probably benign	Het
Cyp2j6	T	A	4: 96,535,471	Y220F	probably benign	Het
D130043K22Rik	A	G	13: 24,893,408	D1008G	probably damaging	Het
Ddx47	T	A	6: 135,023,373	V444E	possibly damaging	Het
Dnttip2	T	A	3: 122,276,532	C465*	probably null	Het
Dst	C	A	1: 34,182,798	S2561*	probably null	Het
Dstyk	T	C	1: 132,454,109	S534P	probably benign	Het
Eif4e	A	G	3: 138,527,182		probably benign	Het
Eipr1	C	T	12: 28,751,818		probably benign	Het
Fastkd2	T	A	1: 63,731,873	D129E	possibly damaging	Het
Fndc3b	C	T	3: 27,501,469	G312D	probably benign	Het
Gab2	T	A	7: 97,303,083	I562N	probably damaging	Het
Gata5	C	A	2: 180,333,892	D160Y	possibly damaging	Het
Gcn1l1	G	A	5: 115,611,144	V1912I	probably damaging	Het
Gdf5	C	A	2: 155,944,735	Q107H	probably damaging	Het
Gdpd1	A	G	11: 87,035,292	Y276H	probably damaging	Het
Gins1	A	G	2: 150,917,871	Y81C	probably damaging	Het
Gm28360	T	C	1: 117,853,599	C107R	probably damaging	Het
Hadha	T	C	5: 30,120,000		probably null	Het
Hcn4	A	T	9: 58,823,584	I25F	unknown	Het
Hectd4	A	G	5: 121,299,597	Y1095C	possibly damaging	Het
Hsp90b1	A	T	10: 86,695,866	L73Q	probably damaging	Het
Hspa12a	A	G	19: 58,804,700	V351A	probably damaging	Het
Htr1b	T	A	9: 81,632,243	M104L	probably benign	Het
Ick	C	T	9: 78,109,202		probably benign	Het
Igf2r	T	C	17: 12,698,325	T1563A	probably benign	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Liph	A	T	16: 21,976,259	V201E	probably damaging	Het
Ltn1	T	C	16: 87,424,871	D196G	probably damaging	Het
Med15	C	T	16: 17,652,727	D589N	possibly damaging	Het
Mknk1	A	G	4: 115,857,110	D26G	probably damaging	Het
Mpi	T	C	9: 57,545,217	D344G	probably damaging	Het
Mrc2	A	G	11: 105,332,236	E435G	possibly damaging	Het
Mrps5	A	G	2: 127,600,866	E285G	probably damaging	Het
Muc16	T	A	9: 18,620,468	M6197L	probably damaging	Het
Myo3b	A	T	2: 70,095,208	E34D	probably benign	Het
Nsd3	T	C	8: 25,641,263	S215P	probably damaging	Het
Nsmce2	T	A	15: 59,496,830		probably benign	Het
Ntan1	T	C	16: 13,826,910	S37P	probably benign	Het
Nup210l	T	A	3: 90,159,947	Y765N	probably damaging	Het
Olfr1193	A	T	2: 88,678,741	R288S	probably damaging	Het
Olfr1495	A	T	19: 13,768,351	D3V	probably benign	Het
Olfr223	T	C	11: 59,589,582	Y169C	possibly damaging	Het
Olfr849	A	C	9: 19,441,592	L226F	possibly damaging	Het
Pald1	T	C	10: 61,339,299	H724R	probably benign	Het
Pcdhb7	A	T	18: 37,342,204	D131V	possibly damaging	Het
Pds5b	G	T	5: 150,800,760	R1269S	probably benign	Het
Pikfyve	T	C	1: 65,234,361	V645A	probably damaging	Het
Plag1	G	T	4: 3,904,676	H172N	probably damaging	Het
Plch2	G	C	4: 154,990,032		probably null	Het
Plxnb1	T	A	9: 109,100,385	V103E	probably damaging	Het
Ptpn18	T	A	1: 34,459,825	M1K	probably null	Het
Rasgrf2	G	A	13: 91,982,833	T703I	possibly damaging	Het
Rassf6	A	T	5: 90,609,725	H125Q	probably benign	Het
Sdad1	A	G	5: 92,298,190		probably null	Het
Sf3a3	T	A	4: 124,728,426	F426L	probably benign	Het
Sgsm3	T	C	15: 81,008,375	F6L	possibly damaging	Het
Slc14a2	A	T	18: 78,159,037	I626N	probably damaging	Het
Slc17a8	T	C	10: 89,600,221	N165S	probably benign	Het
Slc41a1	C	A	1: 131,842,057	A305D	possibly damaging	Het
Smyd4	C	A	11: 75,390,514	P271Q	probably damaging	Het
Spag17	C	A	3: 99,984,609	H260N	probably benign	Het
Spata2	A	T	2: 167,485,363	V38E	possibly damaging	Het
Sprr2b	CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC	CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC	3: 92,317,519		probably benign	Het
Syt14	T	A	1: 192,983,658		probably benign	Het
Tbx21	A	G	11: 97,099,771	S329P	probably damaging	Het
Tex2	A	T	11: 106,511,900		probably null	Het
Tmem62	A	G	2: 120,993,577	I244M	possibly damaging	Het
Tnks	A	T	8: 34,851,636	N830K	probably damaging	Het
Tox2	A	G	2: 163,314,344	E145G	probably damaging	Het
Tpcn1	T	C	5: 120,585,277	D7G	probably damaging	Het
Ttc28	T	A	5: 111,266,579	M1320K	probably benign	Het
Tubgcp5	T	G	7: 55,805,366	V270G	probably damaging	Het
Unc5a	A	G	13: 55,004,484	R62G	probably damaging	Het
Unc5d	A	G	8: 28,715,721		probably null	Het
Utrn	T	C	10: 12,682,338	H1459R	probably damaging	Het
Vmn2r100	T	A	17: 19,505,001	L64Q	possibly damaging	Het
Wdr55	T	G	18: 36,760,420	L45R	probably damaging	Het
Zfp292	A	G	4: 34,816,357	Y306H	probably damaging	Het
Zfp398	G	T	6: 47,866,309	D300Y	probably damaging	Het
Zfp407	A	G	18: 84,561,857	V377A	probably damaging	Het
Zfp457	G	A	13: 67,293,933	H97Y	probably benign	Het
Zfp467	T	C	6: 48,438,138	T527A	probably damaging	Het

Other mutations in Prpf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01376:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01393:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01395:Prpf8	APN	11	75494295	missense	possibly damaging	0.94
IGL01554:Prpf8	APN	11	75495646	missense	probably damaging	1.00
IGL01560:Prpf8	APN	11	75490406	missense	possibly damaging	0.55
IGL01886:Prpf8	APN	11	75495744	missense	probably benign	0.32
IGL01946:Prpf8	APN	11	75499992	missense	probably damaging	1.00
IGL02022:Prpf8	APN	11	75501834	nonsense	probably null
IGL02077:Prpf8	APN	11	75495809	missense	probably damaging	0.96
IGL02141:Prpf8	APN	11	75490672	missense	possibly damaging	0.68
IGL02455:Prpf8	APN	11	75509258	missense	probably benign	0.32
cutter	UTSW	11	75495426	splice site	probably null
BB009:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
BB019:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
PIT4514001:Prpf8	UTSW	11	75496355	missense	possibly damaging	0.53
R0254:Prpf8	UTSW	11	75506362	missense	possibly damaging	0.93
R0270:Prpf8	UTSW	11	75505249	missense	probably damaging	0.99
R0504:Prpf8	UTSW	11	75501942	splice site	probably benign
R0573:Prpf8	UTSW	11	75490654	missense	probably damaging	1.00
R0613:Prpf8	UTSW	11	75503444	missense	probably damaging	1.00
R0893:Prpf8	UTSW	11	75493949	missense	probably damaging	1.00
R0967:Prpf8	UTSW	11	75494430	missense	probably damaging	1.00
R0975:Prpf8	UTSW	11	75508674	unclassified	probably benign
R1123:Prpf8	UTSW	11	75495285	missense	probably damaging	1.00
R1183:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R1857:Prpf8	UTSW	11	75495423	critical splice donor site	probably null
R1901:Prpf8	UTSW	11	75504744	missense	probably damaging	0.99
R1950:Prpf8	UTSW	11	75496511	missense	possibly damaging	0.72
R2116:Prpf8	UTSW	11	75487721	missense	possibly damaging	0.51
R2147:Prpf8	UTSW	11	75490531	missense	probably benign
R2185:Prpf8	UTSW	11	75487113	nonsense	probably null
R2271:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2272:Prpf8	UTSW	11	75495363	missense	probably damaging	1.00
R2898:Prpf8	UTSW	11	75496034	missense	probably benign	0.00
R3744:Prpf8	UTSW	11	75506721	splice site	probably null
R3893:Prpf8	UTSW	11	75500257	missense	possibly damaging	0.73
R4400:Prpf8	UTSW	11	75490702	missense	possibly damaging	0.63
R4510:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4511:Prpf8	UTSW	11	75491826	missense	probably damaging	0.96
R4784:Prpf8	UTSW	11	75492505	missense	probably damaging	1.00
R5089:Prpf8	UTSW	11	75509228	splice site	probably null
R5186:Prpf8	UTSW	11	75489783	missense	possibly damaging	0.93
R5215:Prpf8	UTSW	11	75500204	missense	probably benign	0.02
R5288:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5362:Prpf8	UTSW	11	75506410	missense	possibly damaging	0.53
R5384:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5386:Prpf8	UTSW	11	75495799	missense	probably damaging	1.00
R5423:Prpf8	UTSW	11	75508958	missense	probably damaging	1.00
R5472:Prpf8	UTSW	11	75503643	missense	possibly damaging	0.89
R5539:Prpf8	UTSW	11	75503638	missense	probably benign	0.20
R5620:Prpf8	UTSW	11	75505101	missense	possibly damaging	0.95
R5669:Prpf8	UTSW	11	75504738	missense	probably damaging	1.00
R5887:Prpf8	UTSW	11	75500908	missense	possibly damaging	0.87
R5948:Prpf8	UTSW	11	75509189	missense	possibly damaging	0.95
R6073:Prpf8	UTSW	11	75494022	critical splice donor site	probably null
R6250:Prpf8	UTSW	11	75493508	missense	possibly damaging	0.95
R6358:Prpf8	UTSW	11	75491495	missense	probably benign	0.33
R6629:Prpf8	UTSW	11	75495426	splice site	probably null
R6804:Prpf8	UTSW	11	75499809	missense	possibly damaging	0.71
R6922:Prpf8	UTSW	11	75490736	missense	probably damaging	1.00
R7035:Prpf8	UTSW	11	75504828	missense	possibly damaging	0.72
R7089:Prpf8	UTSW	11	75508548	missense	probably damaging	0.99
R7101:Prpf8	UTSW	11	75490400	missense	possibly damaging	0.85
R7114:Prpf8	UTSW	11	75503355	nonsense	probably null
R7182:Prpf8	UTSW	11	75490727	missense	possibly damaging	0.96
R7290:Prpf8	UTSW	11	75493957	missense	possibly damaging	0.85
R7323:Prpf8	UTSW	11	75491784	missense	probably benign	0.32
R7485:Prpf8	UTSW	11	75508912	nonsense	probably null
R7522:Prpf8	UTSW	11	75509276	missense	possibly damaging	0.82
R7546:Prpf8	UTSW	11	75508374	missense	probably damaging	1.00
R7596:Prpf8	UTSW	11	75491504	missense	probably benign	0.03
R7699:Prpf8	UTSW	11	75500196	missense	probably benign	0.02
R7731:Prpf8	UTSW	11	75508906	missense	probably damaging	0.97
R7821:Prpf8	UTSW	11	75494474	missense	probably benign	0.01
R7932:Prpf8	UTSW	11	75492597	missense	possibly damaging	0.92
R8039:Prpf8	UTSW	11	75502542	missense	possibly damaging	0.95
R8067:Prpf8	UTSW	11	75500150	missense	probably damaging	0.98
R8316:Prpf8	UTSW	11	75499815	missense	possibly damaging	0.71
R8560:Prpf8	UTSW	11	75491774	nonsense	probably null
R8823:Prpf8	UTSW	11	75493456	missense	probably benign	0.05
R8977:Prpf8	UTSW	11	75496044	missense	probably benign	0.12
R9116:Prpf8	UTSW	11	75489763	missense	possibly damaging	0.71
R9166:Prpf8	UTSW	11	75496514	missense	possibly damaging	0.53
R9360:Prpf8	UTSW	11	75490330	missense	possibly damaging	0.95
R9453:Prpf8	UTSW	11	75506386	missense	possibly damaging	0.56
R9518:Prpf8	UTSW	11	75503660	missense	possibly damaging	0.72
R9532:Prpf8	UTSW	11	75494782	missense	probably benign	0.01
R9626:Prpf8	UTSW	11	75494855	missense	possibly damaging	0.53
R9760:Prpf8	UTSW	11	75503431	missense	probably benign	0.20
X0028:Prpf8	UTSW	11	75506764	missense	probably damaging	0.99
Z1177:Prpf8	UTSW	11	75503334	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- CTAGAGTTAGTTCTCAAAGGGTCC -3'
(R):5'- TGATGTCCCAGAACACTGCC -3'

Sequencing Primer
(F):5'- CTCAAAGGGTCCTAGTATATTTGGAG -3'
(R):5'- TATCCAGAGAACACAGAGGCACTTC -3'

Posted On

2019-05-13