Incidental Mutation 'R7038:Prpf8'
ID 546873
Institutional Source Beutler Lab
Gene Symbol Prpf8
Ensembl Gene ENSMUSG00000020850
Gene Name pre-mRNA processing factor 8
Synonyms Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8
MMRRC Submission 045138-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R7038 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 75377642-75400275 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75386984 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1143 (M1143K)
Ref Sequence ENSEMBL: ENSMUSP00000099568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]
AlphaFold Q99PV0
Predicted Effect probably benign
Transcript: ENSMUST00000018449
AA Change: M1143K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: M1143K

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-84 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 393 801 3.6e-226 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1079 7.1e-49 PFAM
Pfam:U5_2-snRNA_bdg 1208 1343 1.9e-73 PFAM
Pfam:U6-snRNA_bdg 1442 1601 3.7e-97 PFAM
Pfam:PRP8_domainIV 1760 1990 1.5e-132 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102510
AA Change: M1143K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: M1143K

DomainStartEndE-ValueType
Pfam:PRO8NT 58 209 1.6e-90 PFAM
low complexity region 369 388 N/A INTRINSIC
Pfam:PROCN 395 801 2.9e-239 PFAM
low complexity region 802 814 N/A INTRINSIC
Pfam:RRM_4 986 1077 1.5e-51 PFAM
Pfam:U5_2-snRNA_bdg 1210 1343 1.1e-77 PFAM
Pfam:U6-snRNA_bdg 1442 1600 4.2e-97 PFAM
Pfam:PRP8_domainIV 1760 1989 9.8e-134 PFAM
JAB_MPN 2099 2233 9.02e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131283
SMART Domains Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850

DomainStartEndE-ValueType
Pfam:PRO8NT 58 92 1.9e-13 PFAM
Pfam:PRO8NT 90 154 2.5e-30 PFAM
low complexity region 314 333 N/A INTRINSIC
Pfam:PROCN 338 746 1.7e-226 PFAM
low complexity region 747 759 N/A INTRINSIC
Pfam:RRM_4 931 1024 5.3e-49 PFAM
Meta Mutation Damage Score 0.8256 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (101/102)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T C 1: 156,468,979 (GRCm39) S748P possibly damaging Het
Alppl2 T C 1: 87,016,833 (GRCm39) D104G probably damaging Het
Als2 C A 1: 59,206,673 (GRCm39) W1590L possibly damaging Het
Aopep G T 13: 63,338,339 (GRCm39) V571F possibly damaging Het
Aplf C T 6: 87,630,805 (GRCm39) W210* probably null Het
Ash1l A T 3: 88,889,978 (GRCm39) H619L probably benign Het
Baiap3 G A 17: 25,462,814 (GRCm39) R1075C probably benign Het
Bpifb1 G T 2: 154,044,589 (GRCm39) V19F probably damaging Het
Capn1 A T 19: 6,064,349 (GRCm39) L50Q probably benign Het
Carmil1 A G 13: 24,323,318 (GRCm39) S245P probably damaging Het
Cavin4 A G 4: 48,672,479 (GRCm39) H308R probably benign Het
Cd4 C T 6: 124,847,217 (GRCm39) V316M probably damaging Het
Cdcp1 T C 9: 123,002,662 (GRCm39) Y803C probably damaging Het
Cep295nl A G 11: 118,223,815 (GRCm39) I343T probably benign Het
Cgn T G 3: 94,670,392 (GRCm39) T1021P possibly damaging Het
Cilk1 C T 9: 78,016,484 (GRCm39) probably benign Het
Col6a5 A G 9: 105,822,937 (GRCm39) V140A unknown Het
Cops8 T C 1: 90,531,320 (GRCm39) probably benign Het
Crhbp A G 13: 95,580,699 (GRCm39) Y54H probably damaging Het
Cyp2c29 G A 19: 39,275,571 (GRCm39) V4I probably benign Het
Cyp2j6 T A 4: 96,423,708 (GRCm39) Y220F probably benign Het
D130043K22Rik A G 13: 25,077,391 (GRCm39) D1008G probably damaging Het
Ddx47 T A 6: 135,000,336 (GRCm39) V444E possibly damaging Het
Dnttip2 T A 3: 122,070,181 (GRCm39) C465* probably null Het
Dst C A 1: 34,221,879 (GRCm39) S2561* probably null Het
Dstyk T C 1: 132,381,847 (GRCm39) S534P probably benign Het
Eif4e A G 3: 138,232,943 (GRCm39) probably benign Het
Eipr1 C T 12: 28,801,817 (GRCm39) probably benign Het
Fastkd2 T A 1: 63,771,032 (GRCm39) D129E possibly damaging Het
Fndc3b C T 3: 27,555,618 (GRCm39) G312D probably benign Het
Gab2 T A 7: 96,952,290 (GRCm39) I562N probably damaging Het
Gata5 C A 2: 179,975,685 (GRCm39) D160Y possibly damaging Het
Gcn1 G A 5: 115,749,203 (GRCm39) V1912I probably damaging Het
Gdf5 C A 2: 155,786,655 (GRCm39) Q107H probably damaging Het
Gdpd1 A G 11: 86,926,118 (GRCm39) Y276H probably damaging Het
Gins1 A G 2: 150,759,791 (GRCm39) Y81C probably damaging Het
Gm28360 T C 1: 117,781,329 (GRCm39) C107R probably damaging Het
Hadha T C 5: 30,324,998 (GRCm39) probably null Het
Hcn4 A T 9: 58,730,867 (GRCm39) I25F unknown Het
Hectd4 A G 5: 121,437,660 (GRCm39) Y1095C possibly damaging Het
Hsp90b1 A T 10: 86,531,730 (GRCm39) L73Q probably damaging Het
Hspa12a A G 19: 58,793,132 (GRCm39) V351A probably damaging Het
Htr1b T A 9: 81,514,296 (GRCm39) M104L probably benign Het
Igf2r T C 17: 12,917,212 (GRCm39) T1563A probably benign Het
Kif13a C T 13: 46,905,931 (GRCm39) V671M possibly damaging Het
Liph A T 16: 21,795,009 (GRCm39) V201E probably damaging Het
Ltn1 T C 16: 87,221,759 (GRCm39) D196G probably damaging Het
Med15 C T 16: 17,470,591 (GRCm39) D589N possibly damaging Het
Mknk1 A G 4: 115,714,307 (GRCm39) D26G probably damaging Het
Mpi T C 9: 57,452,500 (GRCm39) D344G probably damaging Het
Mrc2 A G 11: 105,223,062 (GRCm39) E435G possibly damaging Het
Mrps5 A G 2: 127,442,786 (GRCm39) E285G probably damaging Het
Ms4a20 A T 19: 11,087,675 (GRCm39) F85L probably benign Het
Muc16 T A 9: 18,531,764 (GRCm39) M6197L probably damaging Het
Myo3b A T 2: 69,925,552 (GRCm39) E34D probably benign Het
Nsd3 T C 8: 26,131,279 (GRCm39) S215P probably damaging Het
Nsmce2 T A 15: 59,368,679 (GRCm39) probably benign Het
Ntan1 T C 16: 13,644,774 (GRCm39) S37P probably benign Het
Nup210l T A 3: 90,067,254 (GRCm39) Y765N probably damaging Het
Or10q12 A T 19: 13,745,715 (GRCm39) D3V probably benign Het
Or2aa1 T C 11: 59,480,408 (GRCm39) Y169C possibly damaging Het
Or4s2b A T 2: 88,509,085 (GRCm39) R288S probably damaging Het
Or7g30 A C 9: 19,352,888 (GRCm39) L226F possibly damaging Het
Pald1 T C 10: 61,175,078 (GRCm39) H724R probably benign Het
Pcdhb7 A T 18: 37,475,257 (GRCm39) D131V possibly damaging Het
Pds5b G T 5: 150,724,225 (GRCm39) R1269S probably benign Het
Pikfyve T C 1: 65,273,520 (GRCm39) V645A probably damaging Het
Plag1 G T 4: 3,904,676 (GRCm39) H172N probably damaging Het
Plch2 G C 4: 155,074,489 (GRCm39) probably null Het
Plxnb1 T A 9: 108,929,453 (GRCm39) V103E probably damaging Het
Ptpn18 T A 1: 34,498,906 (GRCm39) M1K probably null Het
Rasgrf2 G A 13: 92,130,952 (GRCm39) T703I possibly damaging Het
Rassf6 A T 5: 90,757,584 (GRCm39) H125Q probably benign Het
Sdad1 A G 5: 92,446,049 (GRCm39) probably null Het
Sf3a3 T A 4: 124,622,219 (GRCm39) F426L probably benign Het
Sgsm3 T C 15: 80,892,576 (GRCm39) F6L possibly damaging Het
Slc14a2 A T 18: 78,202,252 (GRCm39) I626N probably damaging Het
Slc17a8 T C 10: 89,436,083 (GRCm39) N165S probably benign Het
Slc41a1 C A 1: 131,769,795 (GRCm39) A305D possibly damaging Het
Smyd4 C A 11: 75,281,340 (GRCm39) P271Q probably damaging Het
Spag17 C A 3: 99,891,925 (GRCm39) H260N probably benign Het
Spata2 A T 2: 167,327,283 (GRCm39) V38E possibly damaging Het
Sprr2b CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC 3: 92,224,826 (GRCm39) probably benign Het
Syt14 T A 1: 192,665,966 (GRCm39) probably benign Het
Tbx21 A G 11: 96,990,597 (GRCm39) S329P probably damaging Het
Tex2 A T 11: 106,402,726 (GRCm39) probably null Het
Tmem62 A G 2: 120,824,058 (GRCm39) I244M possibly damaging Het
Tnks A T 8: 35,318,790 (GRCm39) N830K probably damaging Het
Tox2 A G 2: 163,156,264 (GRCm39) E145G probably damaging Het
Tpcn1 T C 5: 120,723,342 (GRCm39) D7G probably damaging Het
Ttc28 T A 5: 111,414,445 (GRCm39) M1320K probably benign Het
Tubgcp5 T G 7: 55,455,114 (GRCm39) V270G probably damaging Het
Unc5a A G 13: 55,152,297 (GRCm39) R62G probably damaging Het
Unc5d A G 8: 29,205,749 (GRCm39) probably null Het
Utrn T C 10: 12,558,082 (GRCm39) H1459R probably damaging Het
Vmn2r100 T A 17: 19,725,263 (GRCm39) L64Q possibly damaging Het
Wdr55 T G 18: 36,893,473 (GRCm39) L45R probably damaging Het
Zfp292 A G 4: 34,816,357 (GRCm39) Y306H probably damaging Het
Zfp398 G T 6: 47,843,243 (GRCm39) D300Y probably damaging Het
Zfp407 A G 18: 84,579,982 (GRCm39) V377A probably damaging Het
Zfp457 G A 13: 67,441,997 (GRCm39) H97Y probably benign Het
Zfp467 T C 6: 48,415,072 (GRCm39) T527A probably damaging Het
Other mutations in Prpf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01376:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01393:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01395:Prpf8 APN 11 75,385,121 (GRCm39) missense possibly damaging 0.94
IGL01554:Prpf8 APN 11 75,386,472 (GRCm39) missense probably damaging 1.00
IGL01560:Prpf8 APN 11 75,381,232 (GRCm39) missense possibly damaging 0.55
IGL01886:Prpf8 APN 11 75,386,570 (GRCm39) missense probably benign 0.32
IGL01946:Prpf8 APN 11 75,390,818 (GRCm39) missense probably damaging 1.00
IGL02022:Prpf8 APN 11 75,392,660 (GRCm39) nonsense probably null
IGL02077:Prpf8 APN 11 75,386,635 (GRCm39) missense probably damaging 0.96
IGL02141:Prpf8 APN 11 75,381,498 (GRCm39) missense possibly damaging 0.68
IGL02455:Prpf8 APN 11 75,400,084 (GRCm39) missense probably benign 0.32
cutter UTSW 11 75,386,252 (GRCm39) splice site probably null
BB009:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
BB019:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
PIT4514001:Prpf8 UTSW 11 75,387,181 (GRCm39) missense possibly damaging 0.53
R0254:Prpf8 UTSW 11 75,397,188 (GRCm39) missense possibly damaging 0.93
R0270:Prpf8 UTSW 11 75,396,075 (GRCm39) missense probably damaging 0.99
R0504:Prpf8 UTSW 11 75,392,768 (GRCm39) splice site probably benign
R0573:Prpf8 UTSW 11 75,381,480 (GRCm39) missense probably damaging 1.00
R0613:Prpf8 UTSW 11 75,394,270 (GRCm39) missense probably damaging 1.00
R0893:Prpf8 UTSW 11 75,384,775 (GRCm39) missense probably damaging 1.00
R0967:Prpf8 UTSW 11 75,385,256 (GRCm39) missense probably damaging 1.00
R0975:Prpf8 UTSW 11 75,399,500 (GRCm39) unclassified probably benign
R1123:Prpf8 UTSW 11 75,386,111 (GRCm39) missense probably damaging 1.00
R1183:Prpf8 UTSW 11 75,381,156 (GRCm39) missense possibly damaging 0.95
R1857:Prpf8 UTSW 11 75,386,249 (GRCm39) critical splice donor site probably null
R1901:Prpf8 UTSW 11 75,395,570 (GRCm39) missense probably damaging 0.99
R1950:Prpf8 UTSW 11 75,387,337 (GRCm39) missense possibly damaging 0.72
R2116:Prpf8 UTSW 11 75,378,547 (GRCm39) missense possibly damaging 0.51
R2147:Prpf8 UTSW 11 75,381,357 (GRCm39) missense probably benign
R2185:Prpf8 UTSW 11 75,377,939 (GRCm39) nonsense probably null
R2271:Prpf8 UTSW 11 75,386,189 (GRCm39) missense probably damaging 1.00
R2272:Prpf8 UTSW 11 75,386,189 (GRCm39) missense probably damaging 1.00
R2898:Prpf8 UTSW 11 75,386,860 (GRCm39) missense probably benign 0.00
R3744:Prpf8 UTSW 11 75,397,547 (GRCm39) splice site probably null
R3893:Prpf8 UTSW 11 75,391,083 (GRCm39) missense possibly damaging 0.73
R4400:Prpf8 UTSW 11 75,381,528 (GRCm39) missense possibly damaging 0.63
R4510:Prpf8 UTSW 11 75,382,652 (GRCm39) missense probably damaging 0.96
R4511:Prpf8 UTSW 11 75,382,652 (GRCm39) missense probably damaging 0.96
R4784:Prpf8 UTSW 11 75,383,331 (GRCm39) missense probably damaging 1.00
R5089:Prpf8 UTSW 11 75,400,054 (GRCm39) splice site probably null
R5186:Prpf8 UTSW 11 75,380,609 (GRCm39) missense possibly damaging 0.93
R5215:Prpf8 UTSW 11 75,391,030 (GRCm39) missense probably benign 0.02
R5288:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5362:Prpf8 UTSW 11 75,397,236 (GRCm39) missense possibly damaging 0.53
R5384:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5386:Prpf8 UTSW 11 75,386,625 (GRCm39) missense probably damaging 1.00
R5423:Prpf8 UTSW 11 75,399,784 (GRCm39) missense probably damaging 1.00
R5472:Prpf8 UTSW 11 75,394,469 (GRCm39) missense possibly damaging 0.89
R5539:Prpf8 UTSW 11 75,394,464 (GRCm39) missense probably benign 0.20
R5620:Prpf8 UTSW 11 75,395,927 (GRCm39) missense possibly damaging 0.95
R5669:Prpf8 UTSW 11 75,395,564 (GRCm39) missense probably damaging 1.00
R5887:Prpf8 UTSW 11 75,391,734 (GRCm39) missense possibly damaging 0.87
R5948:Prpf8 UTSW 11 75,400,015 (GRCm39) missense possibly damaging 0.95
R6073:Prpf8 UTSW 11 75,384,848 (GRCm39) critical splice donor site probably null
R6250:Prpf8 UTSW 11 75,384,334 (GRCm39) missense possibly damaging 0.95
R6358:Prpf8 UTSW 11 75,382,321 (GRCm39) missense probably benign 0.33
R6629:Prpf8 UTSW 11 75,386,252 (GRCm39) splice site probably null
R6804:Prpf8 UTSW 11 75,390,635 (GRCm39) missense possibly damaging 0.71
R6922:Prpf8 UTSW 11 75,381,562 (GRCm39) missense probably damaging 1.00
R7035:Prpf8 UTSW 11 75,395,654 (GRCm39) missense possibly damaging 0.72
R7089:Prpf8 UTSW 11 75,399,374 (GRCm39) missense probably damaging 0.99
R7101:Prpf8 UTSW 11 75,381,226 (GRCm39) missense possibly damaging 0.85
R7114:Prpf8 UTSW 11 75,394,181 (GRCm39) nonsense probably null
R7182:Prpf8 UTSW 11 75,381,553 (GRCm39) missense possibly damaging 0.96
R7290:Prpf8 UTSW 11 75,384,783 (GRCm39) missense possibly damaging 0.85
R7323:Prpf8 UTSW 11 75,382,610 (GRCm39) missense probably benign 0.32
R7485:Prpf8 UTSW 11 75,399,738 (GRCm39) nonsense probably null
R7522:Prpf8 UTSW 11 75,400,102 (GRCm39) missense possibly damaging 0.82
R7546:Prpf8 UTSW 11 75,399,200 (GRCm39) missense probably damaging 1.00
R7596:Prpf8 UTSW 11 75,382,330 (GRCm39) missense probably benign 0.03
R7699:Prpf8 UTSW 11 75,391,022 (GRCm39) missense probably benign 0.02
R7731:Prpf8 UTSW 11 75,399,732 (GRCm39) missense probably damaging 0.97
R7821:Prpf8 UTSW 11 75,385,300 (GRCm39) missense probably benign 0.01
R7932:Prpf8 UTSW 11 75,383,423 (GRCm39) missense possibly damaging 0.92
R8039:Prpf8 UTSW 11 75,393,368 (GRCm39) missense possibly damaging 0.95
R8067:Prpf8 UTSW 11 75,390,976 (GRCm39) missense probably damaging 0.98
R8316:Prpf8 UTSW 11 75,390,641 (GRCm39) missense possibly damaging 0.71
R8560:Prpf8 UTSW 11 75,382,600 (GRCm39) nonsense probably null
R8823:Prpf8 UTSW 11 75,384,282 (GRCm39) missense probably benign 0.05
R8977:Prpf8 UTSW 11 75,386,870 (GRCm39) missense probably benign 0.12
R9116:Prpf8 UTSW 11 75,380,589 (GRCm39) missense possibly damaging 0.71
R9166:Prpf8 UTSW 11 75,387,340 (GRCm39) missense possibly damaging 0.53
R9360:Prpf8 UTSW 11 75,381,156 (GRCm39) missense possibly damaging 0.95
R9453:Prpf8 UTSW 11 75,397,212 (GRCm39) missense possibly damaging 0.56
R9518:Prpf8 UTSW 11 75,394,486 (GRCm39) missense possibly damaging 0.72
R9532:Prpf8 UTSW 11 75,385,608 (GRCm39) missense probably benign 0.01
R9626:Prpf8 UTSW 11 75,385,681 (GRCm39) missense possibly damaging 0.53
R9760:Prpf8 UTSW 11 75,394,257 (GRCm39) missense probably benign 0.20
X0028:Prpf8 UTSW 11 75,397,590 (GRCm39) missense probably damaging 0.99
Z1177:Prpf8 UTSW 11 75,394,160 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CTAGAGTTAGTTCTCAAAGGGTCC -3'
(R):5'- TGATGTCCCAGAACACTGCC -3'

Sequencing Primer
(F):5'- CTCAAAGGGTCCTAGTATATTTGGAG -3'
(R):5'- TATCCAGAGAACACAGAGGCACTTC -3'
Posted On 2019-05-13