Incidental Mutation 'R7039:Epha4'
ID546908
Institutional Source Beutler Lab
Gene Symbol Epha4
Ensembl Gene ENSMUSG00000026235
Gene NameEph receptor A4
Synonymsrb, Sek, Sek1, 2900005C20Rik, Cek8, Hek8, Tyro1
MMRRC Submission
Accession Numbers

Genbank: NM_007936; MGI: 98277

Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R7039 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location77367185-77515088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77506785 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 196 (S196P)
Ref Sequence ENSEMBL: ENSMUSP00000139640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027451] [ENSMUST00000186930] [ENSMUST00000188797] [ENSMUST00000188952] [ENSMUST00000190149]
PDB Structure
THE CRYSTAL STRUCTURE OF AN EPH RECEPTOR SAM DOMAIN REVEALS A MECHANISM FOR MODULAR DIMERIZATION. [X-RAY DIFFRACTION]
Crystal structure of a mutant EphA4 kinase domain (Y742A) [X-RAY DIFFRACTION]
[]
Crystal structure of EphA4 kinase domain in complex with VUF 12058 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF EPHA4 KINASE DOMAIN [X-RAY DIFFRACTION]
Crystal structure of EphA4 kinase domain in complex with Dasatinib. [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027451
AA Change: S196P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027451
Gene: ENSMUSG00000026235
AA Change: S196P

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 548 618 1.7e-24 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186930
SMART Domains Protein: ENSMUSP00000140370
Gene: ENSMUSG00000026235

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN3 33 124 9.6e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188797
AA Change: S196P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140954
Gene: ENSMUSG00000026235
AA Change: S196P

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188952
AA Change: S196P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139640
Gene: ENSMUSG00000026235
AA Change: S196P

DomainStartEndE-ValueType
EPH_lbd 30 204 1.35e-128 SMART
FN3 329 420 1.94e-8 SMART
FN3 441 522 9.18e-10 SMART
Pfam:EphA2_TM 547 618 1.8e-27 PFAM
TyrKc 621 878 1.91e-134 SMART
SAM 908 975 1.96e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190149
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mutants are known for their "hopping gait". Homozygotes for targeted null mutations show loss of limb alternation in locomotion and axon guidance defects of the corticospinal tract within medulla and spinal cord, resulting in aberrant midline projections. Heterozygotes show less severe phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(66) : Targeted, knock-out(3) Targeted, other(9) Gene trapped(52) Spontaneous(2)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,140,148 R462Q possibly damaging Het
Actl7b A T 4: 56,741,022 L112Q probably damaging Het
Agap3 A C 5: 24,483,401 I396L probably benign Het
AI987944 G T 7: 41,374,456 S366R probably benign Het
Aox3 A G 1: 58,176,555 T1049A probably damaging Het
Ap1g2 A T 14: 55,102,654 L407* probably null Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Brd3 T C 2: 27,456,917 K402E probably damaging Het
Cc2d2b A T 19: 40,802,401 D935V probably damaging Het
Cenpe A G 3: 135,255,456 N1904D probably benign Het
Cfap74 G T 4: 155,454,108 probably null Het
Chrdl2 A G 7: 100,028,672 T261A probably damaging Het
Cyp4a14 G A 4: 115,491,081 R400C probably benign Het
Dhfr G A 13: 92,355,283 V9I probably benign Het
Evc2 T A 5: 37,421,888 L1115Q probably damaging Het
Fat3 T A 9: 16,376,265 E654V probably damaging Het
Fer1l4 C T 2: 156,036,730 V14I probably benign Het
Frmd5 A T 2: 121,547,647 probably benign Het
Helz T C 11: 107,619,318 probably null Het
Igkv6-13 T C 6: 70,457,514 S116G probably benign Het
Iscu T C 5: 113,776,772 V115A possibly damaging Het
Jade2 C A 11: 51,828,359 K253N probably damaging Het
Katnal2 A G 18: 77,047,172 probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Magi3 T C 3: 104,051,383 D462G probably damaging Het
Map3k14 T C 11: 103,221,035 N940S probably damaging Het
Masp2 A T 4: 148,602,586 M1L probably benign Het
Mga G A 2: 119,932,678 V1272I probably benign Het
Mib2 T C 4: 155,659,701 D168G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Msto1 A C 3: 88,911,390 V287G probably damaging Het
Myo5b T A 18: 74,701,528 D886E probably benign Het
Nek10 T C 14: 14,826,946 I48T possibly damaging Het
Nek10 A T 14: 14,986,700 R1013W probably damaging Het
Nipsnap3a T C 4: 53,000,130 V194A probably damaging Het
Nlrp9a A T 7: 26,567,942 T766S probably benign Het
Nol10 T A 12: 17,429,184 S672T possibly damaging Het
Olfr1062 A T 2: 86,422,833 I281K possibly damaging Het
Olfr1226 A T 2: 89,193,446 I196N probably damaging Het
Olfr1253 A T 2: 89,752,751 F26I probably benign Het
Olfr933 T A 9: 38,975,987 F104I probably damaging Het
Patj T A 4: 98,569,078 N1272K probably damaging Het
Peak1 T C 9: 56,257,809 E945G probably benign Het
Peg3 C T 7: 6,717,859 D16N probably damaging Het
Pik3r4 T G 9: 105,676,890 I1082M possibly damaging Het
Plekhg5 T A 4: 152,107,785 M472K possibly damaging Het
Plekhm1 T C 11: 103,395,228 D127G probably damaging Het
Ppfia4 G A 1: 134,312,115 S908L probably damaging Het
Psmc3 A G 2: 91,055,046 N60S probably benign Het
Rapgef1 T A 2: 29,726,214 D697E probably damaging Het
Rapgef3 T A 15: 97,761,568 H54L probably benign Het
Rhobtb3 G A 13: 75,872,453 R577* probably null Het
Safb2 T C 17: 56,564,594 E218G possibly damaging Het
Scaf1 C T 7: 45,008,426 R343H probably damaging Het
Snx24 G A 18: 53,340,235 probably null Het
Tbc1d1 T C 5: 64,284,757 F707L probably benign Het
Tcaf2 T C 6: 42,626,140 T829A probably damaging Het
Tcea2 C T 2: 181,686,918 Q248* probably null Het
Tcirg1 A T 19: 3,896,666 L729Q probably damaging Het
Thap3 A G 4: 151,985,692 F82L probably damaging Het
Ttk T A 9: 83,868,092 M700K probably damaging Het
Ubap2l G T 3: 90,002,355 P56H probably damaging Het
Ubr2 A G 17: 47,010,213 S3P probably benign Het
Uchl3 C T 14: 101,685,692 probably benign Het
Vmn2r111 T A 17: 22,548,184 E777D probably damaging Het
Vmn2r20 A T 6: 123,386,123 D567E probably damaging Het
Vps13c T G 9: 67,937,763 L2043R probably damaging Het
Zan T G 5: 137,400,134 D4212A unknown Het
Zap70 C T 1: 36,778,751 P278S probably benign Het
Zbtb8b A T 4: 129,427,685 M461K possibly damaging Het
Zfat T G 15: 68,180,362 I528L probably benign Het
Zfp532 T G 18: 65,638,763 V784G probably benign Het
Other mutations in Epha4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Epha4 APN 1 77398557 missense probably benign 0.00
IGL01350:Epha4 APN 1 77506855 missense probably damaging 1.00
IGL01657:Epha4 APN 1 77426838 missense probably damaging 1.00
IGL01872:Epha4 APN 1 77383039 missense probably benign 0.03
IGL02366:Epha4 APN 1 77426711 nonsense probably null
IGL02426:Epha4 APN 1 77444877 missense probably benign 0.01
IGL02428:Epha4 APN 1 77506748 missense possibly damaging 0.94
IGL02706:Epha4 APN 1 77426845 missense probably damaging 1.00
IGL02716:Epha4 APN 1 77380965 missense probably damaging 1.00
IGL03348:Epha4 APN 1 77507172 missense possibly damaging 0.82
frog UTSW 1 77481076 intron probably benign
R0324:Epha4 UTSW 1 77383551 missense probably damaging 1.00
R0392:Epha4 UTSW 1 77506973 missense probably benign 0.00
R0538:Epha4 UTSW 1 77388541 missense probably damaging 1.00
R0562:Epha4 UTSW 1 77388487 missense probably benign 0.00
R0885:Epha4 UTSW 1 77382939 missense probably damaging 0.99
R1509:Epha4 UTSW 1 77380886 missense probably damaging 1.00
R1620:Epha4 UTSW 1 77374926 missense probably benign 0.31
R1624:Epha4 UTSW 1 77399692 missense probably damaging 1.00
R1654:Epha4 UTSW 1 77374768 splice site probably null
R1755:Epha4 UTSW 1 77387823 missense probably damaging 1.00
R1807:Epha4 UTSW 1 77374904 missense probably benign 0.05
R2046:Epha4 UTSW 1 77507162 missense probably damaging 1.00
R2504:Epha4 UTSW 1 77382991 missense probably damaging 1.00
R2509:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R2511:Epha4 UTSW 1 77511702 missense possibly damaging 0.84
R3441:Epha4 UTSW 1 77426696 missense possibly damaging 0.90
R3724:Epha4 UTSW 1 77426543 splice site probably benign
R3901:Epha4 UTSW 1 77380902 missense probably damaging 1.00
R3950:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3951:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R3952:Epha4 UTSW 1 77399716 missense probably damaging 1.00
R4012:Epha4 UTSW 1 77390094 splice site probably benign
R4321:Epha4 UTSW 1 77507213 critical splice acceptor site probably null
R4422:Epha4 UTSW 1 77511717 missense probably damaging 0.99
R4898:Epha4 UTSW 1 77390075 nonsense probably null
R5072:Epha4 UTSW 1 77445002 missense probably damaging 1.00
R5270:Epha4 UTSW 1 77506607 missense probably damaging 1.00
R5281:Epha4 UTSW 1 77374867 missense probably benign
R5315:Epha4 UTSW 1 77388472 critical splice donor site probably null
R5531:Epha4 UTSW 1 77374876 missense probably benign
R5621:Epha4 UTSW 1 77515049 utr 5 prime probably benign
R5648:Epha4 UTSW 1 77398525 missense probably benign 0.25
R5747:Epha4 UTSW 1 77506883 missense probably damaging 0.99
R5829:Epha4 UTSW 1 77444994 missense probably benign 0.01
R6185:Epha4 UTSW 1 77507106 missense probably damaging 1.00
R6486:Epha4 UTSW 1 77383549 missense probably damaging 1.00
R6821:Epha4 UTSW 1 77382945 missense possibly damaging 0.88
R6978:Epha4 UTSW 1 77377583 missense probably damaging 1.00
R7216:Epha4 UTSW 1 77444984 missense probably damaging 1.00
R7270:Epha4 UTSW 1 77399785 missense probably damaging 1.00
R7444:Epha4 UTSW 1 77387916 missense probably damaging 1.00
R7737:Epha4 UTSW 1 77381012 missense probably damaging 1.00
R7763:Epha4 UTSW 1 77390031 critical splice donor site probably null
Z1088:Epha4 UTSW 1 77506662 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- GTACCAGCCATTCACCATCTG -3'
(R):5'- TGCAAGGAGACGTTTAACCTC -3'

Sequencing Primer
(F):5'- GCCCCACAGTACATTTTTGG -3'
(R):5'- CTTCATCAGAGAGAGCCAGTTTG -3'
Posted On2019-05-13