Incidental Mutation 'R7039:Brd3'
ID546910
Institutional Source Beutler Lab
Gene Symbol Brd3
Ensembl Gene ENSMUSG00000026918
Gene Namebromodomain containing 3
SynonymsRINGL3, ORFX, 2410084F24Rik, Fsrg2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.549) question?
Stock #R7039 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location27445579-27507662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27456917 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 402 (K402E)
Ref Sequence ENSEMBL: ENSMUSP00000114422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028282] [ENSMUST00000077737] [ENSMUST00000113941] [ENSMUST00000138693] [ENSMUST00000154316] [ENSMUST00000164296]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028282
AA Change: K402E

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028282
Gene: ENSMUSG00000026918
AA Change: K402E

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
coiled coil region 455 525 N/A INTRINSIC
PDB:2JNS|A 572 645 5e-37 PDB
coiled coil region 649 684 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077737
AA Change: K402E

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076918
Gene: ENSMUSG00000026918
AA Change: K402E

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
coiled coil region 455 525 N/A INTRINSIC
PDB:2JNS|A 572 645 5e-37 PDB
coiled coil region 649 684 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113941
AA Change: K402E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109574
Gene: ENSMUSG00000026918
AA Change: K402E

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
low complexity region 435 459 N/A INTRINSIC
coiled coil region 505 542 N/A INTRINSIC
Pfam:BET 589 653 1.2e-35 PFAM
coiled coil region 666 701 N/A INTRINSIC
low complexity region 708 743 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138693
AA Change: K402E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115755
Gene: ENSMUSG00000026918
AA Change: K402E

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
low complexity region 435 459 N/A INTRINSIC
coiled coil region 505 542 N/A INTRINSIC
PDB:2JNS|A 589 662 4e-37 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000154316
AA Change: K402E

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114422
Gene: ENSMUSG00000026918
AA Change: K402E

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
low complexity region 435 459 N/A INTRINSIC
coiled coil region 505 542 N/A INTRINSIC
PDB:2JNS|A 589 662 4e-37 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000164296
AA Change: K402E

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128812
Gene: ENSMUSG00000026918
AA Change: K402E

DomainStartEndE-ValueType
BROMO 31 141 4.16e-46 SMART
low complexity region 148 179 N/A INTRINSIC
low complexity region 207 236 N/A INTRINSIC
low complexity region 245 269 N/A INTRINSIC
BROMO 307 416 7.64e-45 SMART
coiled coil region 455 525 N/A INTRINSIC
Pfam:BET 572 636 1.5e-35 PFAM
coiled coil region 649 684 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on its homology to the gene encoding the RING3 protein, a serine/threonine kinase. The gene localizes to 9q34, a region which contains several major histocompatibility complex (MHC) genes. The function of the encoded protein is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,140,148 R462Q possibly damaging Het
Actl7b A T 4: 56,741,022 L112Q probably damaging Het
Agap3 A C 5: 24,483,401 I396L probably benign Het
AI987944 G T 7: 41,374,456 S366R probably benign Het
Aox3 A G 1: 58,176,555 T1049A probably damaging Het
Ap1g2 A T 14: 55,102,654 L407* probably null Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Cc2d2b A T 19: 40,802,401 D935V probably damaging Het
Cenpe A G 3: 135,255,456 N1904D probably benign Het
Cfap74 G T 4: 155,454,108 probably null Het
Chrdl2 A G 7: 100,028,672 T261A probably damaging Het
Cyp4a14 G A 4: 115,491,081 R400C probably benign Het
Dhfr G A 13: 92,355,283 V9I probably benign Het
Epha4 A G 1: 77,506,785 S196P probably damaging Het
Evc2 T A 5: 37,421,888 L1115Q probably damaging Het
Fat3 T A 9: 16,376,265 E654V probably damaging Het
Fer1l4 C T 2: 156,036,730 V14I probably benign Het
Frmd5 A T 2: 121,547,647 probably benign Het
Helz T C 11: 107,619,318 probably null Het
Igkv6-13 T C 6: 70,457,514 S116G probably benign Het
Iscu T C 5: 113,776,772 V115A possibly damaging Het
Jade2 C A 11: 51,828,359 K253N probably damaging Het
Katnal2 A G 18: 77,047,172 probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Magi3 T C 3: 104,051,383 D462G probably damaging Het
Map3k14 T C 11: 103,221,035 N940S probably damaging Het
Masp2 A T 4: 148,602,586 M1L probably benign Het
Mga G A 2: 119,932,678 V1272I probably benign Het
Mib2 T C 4: 155,659,701 D168G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Msto1 A C 3: 88,911,390 V287G probably damaging Het
Myo5b T A 18: 74,701,528 D886E probably benign Het
Nek10 T C 14: 14,826,946 I48T possibly damaging Het
Nek10 A T 14: 14,986,700 R1013W probably damaging Het
Nipsnap3a T C 4: 53,000,130 V194A probably damaging Het
Nlrp9a A T 7: 26,567,942 T766S probably benign Het
Nol10 T A 12: 17,429,184 S672T possibly damaging Het
Olfr1062 A T 2: 86,422,833 I281K possibly damaging Het
Olfr1226 A T 2: 89,193,446 I196N probably damaging Het
Olfr1253 A T 2: 89,752,751 F26I probably benign Het
Olfr933 T A 9: 38,975,987 F104I probably damaging Het
Patj T A 4: 98,569,078 N1272K probably damaging Het
Peak1 T C 9: 56,257,809 E945G probably benign Het
Peg3 C T 7: 6,717,859 D16N probably damaging Het
Pik3r4 T G 9: 105,676,890 I1082M possibly damaging Het
Plekhg5 T A 4: 152,107,785 M472K possibly damaging Het
Plekhm1 T C 11: 103,395,228 D127G probably damaging Het
Ppfia4 G A 1: 134,312,115 S908L probably damaging Het
Psmc3 A G 2: 91,055,046 N60S probably benign Het
Rapgef1 T A 2: 29,726,214 D697E probably damaging Het
Rapgef3 T A 15: 97,761,568 H54L probably benign Het
Rhobtb3 G A 13: 75,872,453 R577* probably null Het
Safb2 T C 17: 56,564,594 E218G possibly damaging Het
Scaf1 C T 7: 45,008,426 R343H probably damaging Het
Snx24 G A 18: 53,340,235 probably null Het
Tbc1d1 T C 5: 64,284,757 F707L probably benign Het
Tcaf2 T C 6: 42,626,140 T829A probably damaging Het
Tcea2 C T 2: 181,686,918 Q248* probably null Het
Tcirg1 A T 19: 3,896,666 L729Q probably damaging Het
Thap3 A G 4: 151,985,692 F82L probably damaging Het
Ttk T A 9: 83,868,092 M700K probably damaging Het
Ubap2l G T 3: 90,002,355 P56H probably damaging Het
Ubr2 A G 17: 47,010,213 S3P probably benign Het
Uchl3 C T 14: 101,685,692 probably benign Het
Vmn2r111 T A 17: 22,548,184 E777D probably damaging Het
Vmn2r20 A T 6: 123,386,123 D567E probably damaging Het
Vps13c T G 9: 67,937,763 L2043R probably damaging Het
Zan T G 5: 137,400,134 D4212A unknown Het
Zap70 C T 1: 36,778,751 P278S probably benign Het
Zbtb8b A T 4: 129,427,685 M461K possibly damaging Het
Zfat T G 15: 68,180,362 I528L probably benign Het
Zfp532 T G 18: 65,638,763 V784G probably benign Het
Other mutations in Brd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Brd3 APN 2 27464089 missense possibly damaging 0.53
IGL01685:Brd3 APN 2 27459488 missense probably damaging 1.00
IGL01911:Brd3 APN 2 27459800 missense probably damaging 1.00
IGL02105:Brd3 APN 2 27459776 missense probably damaging 1.00
IGL02649:Brd3 APN 2 27454350 missense probably damaging 1.00
IGL02715:Brd3 APN 2 27454483 missense possibly damaging 0.66
IGL02825:Brd3 APN 2 27449263 missense probably damaging 1.00
IGL02898:Brd3 APN 2 27459741 missense possibly damaging 0.81
H8562:Brd3 UTSW 2 27450533 missense possibly damaging 0.53
R1263:Brd3 UTSW 2 27462522 missense probably damaging 1.00
R1449:Brd3 UTSW 2 27450251 splice site probably null
R1449:Brd3 UTSW 2 27457016 missense probably damaging 1.00
R4351:Brd3 UTSW 2 27457016 missense probably damaging 1.00
R4840:Brd3 UTSW 2 27449239 missense possibly damaging 0.94
R5049:Brd3 UTSW 2 27450577 intron probably benign
R5131:Brd3 UTSW 2 27453415 missense probably benign
R5185:Brd3 UTSW 2 27462448 missense probably damaging 1.00
R5213:Brd3 UTSW 2 27463948 missense possibly damaging 0.81
R5261:Brd3 UTSW 2 27463919 missense probably damaging 0.99
R5326:Brd3 UTSW 2 27450544 missense probably benign
R5661:Brd3 UTSW 2 27461572 missense possibly damaging 0.68
R6439:Brd3 UTSW 2 27463926 missense probably damaging 1.00
R6952:Brd3 UTSW 2 27454359 missense probably damaging 1.00
R7103:Brd3 UTSW 2 27450394 missense probably damaging 0.97
R7168:Brd3 UTSW 2 27454399 missense possibly damaging 0.87
R7730:Brd3 UTSW 2 27456955 missense probably damaging 1.00
R7960:Brd3 UTSW 2 27452933 missense probably benign 0.03
R8272:Brd3 UTSW 2 27461713 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TAGCAGGATCTCACACAGGTAG -3'
(R):5'- ATTGCCAGATGCCTGACTG -3'

Sequencing Primer
(F):5'- CACAGGTAGTGGGCTGTG -3'
(R):5'- ATGTTCTGAGGATCTAAGTCTATCCC -3'
Posted On2019-05-13