Incidental Mutation 'R7039:Olfr1226'
ID546913
Institutional Source Beutler Lab
Gene Symbol Olfr1226
Ensembl Gene ENSMUSG00000075097
Gene Nameolfactory receptor 1226
SynonymsGA_x6K02T2Q125-50672630-50671698, MOR233-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R7039 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89188839-89200048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89193446 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 196 (I196N)
Ref Sequence ENSEMBL: ENSMUSP00000151855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099790] [ENSMUST00000214709] [ENSMUST00000215562] [ENSMUST00000215987] [ENSMUST00000216445] [ENSMUST00000217601] [ENSMUST00000220416]
Predicted Effect probably damaging
Transcript: ENSMUST00000099790
AA Change: I196N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097378
Gene: ENSMUSG00000075097
AA Change: I196N

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 6.5e-47 PFAM
Pfam:7tm_1 39 285 3.4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214709
AA Change: I196N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000215562
AA Change: I196N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000215987
AA Change: I196N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000216445
AA Change: I196N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000217601
AA Change: I196N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000220416
AA Change: I196N

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,140,148 R462Q possibly damaging Het
Actl7b A T 4: 56,741,022 L112Q probably damaging Het
Agap3 A C 5: 24,483,401 I396L probably benign Het
AI987944 G T 7: 41,374,456 S366R probably benign Het
Aox3 A G 1: 58,176,555 T1049A probably damaging Het
Ap1g2 A T 14: 55,102,654 L407* probably null Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Brd3 T C 2: 27,456,917 K402E probably damaging Het
Cc2d2b A T 19: 40,802,401 D935V probably damaging Het
Cenpe A G 3: 135,255,456 N1904D probably benign Het
Cfap74 G T 4: 155,454,108 probably null Het
Chrdl2 A G 7: 100,028,672 T261A probably damaging Het
Cyp4a14 G A 4: 115,491,081 R400C probably benign Het
Dhfr G A 13: 92,355,283 V9I probably benign Het
Epha4 A G 1: 77,506,785 S196P probably damaging Het
Evc2 T A 5: 37,421,888 L1115Q probably damaging Het
Fat3 T A 9: 16,376,265 E654V probably damaging Het
Fer1l4 C T 2: 156,036,730 V14I probably benign Het
Frmd5 A T 2: 121,547,647 probably benign Het
Helz T C 11: 107,619,318 probably null Het
Igkv6-13 T C 6: 70,457,514 S116G probably benign Het
Iscu T C 5: 113,776,772 V115A possibly damaging Het
Jade2 C A 11: 51,828,359 K253N probably damaging Het
Katnal2 A G 18: 77,047,172 probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Magi3 T C 3: 104,051,383 D462G probably damaging Het
Map3k14 T C 11: 103,221,035 N940S probably damaging Het
Masp2 A T 4: 148,602,586 M1L probably benign Het
Mga G A 2: 119,932,678 V1272I probably benign Het
Mib2 T C 4: 155,659,701 D168G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Msto1 A C 3: 88,911,390 V287G probably damaging Het
Myo5b T A 18: 74,701,528 D886E probably benign Het
Nek10 T C 14: 14,826,946 I48T possibly damaging Het
Nek10 A T 14: 14,986,700 R1013W probably damaging Het
Nipsnap3a T C 4: 53,000,130 V194A probably damaging Het
Nlrp9a A T 7: 26,567,942 T766S probably benign Het
Nol10 T A 12: 17,429,184 S672T possibly damaging Het
Olfr1062 A T 2: 86,422,833 I281K possibly damaging Het
Olfr1253 A T 2: 89,752,751 F26I probably benign Het
Olfr933 T A 9: 38,975,987 F104I probably damaging Het
Patj T A 4: 98,569,078 N1272K probably damaging Het
Peak1 T C 9: 56,257,809 E945G probably benign Het
Peg3 C T 7: 6,717,859 D16N probably damaging Het
Pik3r4 T G 9: 105,676,890 I1082M possibly damaging Het
Plekhg5 T A 4: 152,107,785 M472K possibly damaging Het
Plekhm1 T C 11: 103,395,228 D127G probably damaging Het
Ppfia4 G A 1: 134,312,115 S908L probably damaging Het
Psmc3 A G 2: 91,055,046 N60S probably benign Het
Rapgef1 T A 2: 29,726,214 D697E probably damaging Het
Rapgef3 T A 15: 97,761,568 H54L probably benign Het
Rhobtb3 G A 13: 75,872,453 R577* probably null Het
Safb2 T C 17: 56,564,594 E218G possibly damaging Het
Scaf1 C T 7: 45,008,426 R343H probably damaging Het
Snx24 G A 18: 53,340,235 probably null Het
Tbc1d1 T C 5: 64,284,757 F707L probably benign Het
Tcaf2 T C 6: 42,626,140 T829A probably damaging Het
Tcea2 C T 2: 181,686,918 Q248* probably null Het
Tcirg1 A T 19: 3,896,666 L729Q probably damaging Het
Thap3 A G 4: 151,985,692 F82L probably damaging Het
Ttk T A 9: 83,868,092 M700K probably damaging Het
Ubap2l G T 3: 90,002,355 P56H probably damaging Het
Ubr2 A G 17: 47,010,213 S3P probably benign Het
Uchl3 C T 14: 101,685,692 probably benign Het
Vmn2r111 T A 17: 22,548,184 E777D probably damaging Het
Vmn2r20 A T 6: 123,386,123 D567E probably damaging Het
Vps13c T G 9: 67,937,763 L2043R probably damaging Het
Zan T G 5: 137,400,134 D4212A unknown Het
Zap70 C T 1: 36,778,751 P278S probably benign Het
Zbtb8b A T 4: 129,427,685 M461K possibly damaging Het
Zfat T G 15: 68,180,362 I528L probably benign Het
Zfp532 T G 18: 65,638,763 V784G probably benign Het
Other mutations in Olfr1226
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Olfr1226 APN 2 89193504 missense probably benign 0.00
IGL01073:Olfr1226 APN 2 89193137 missense possibly damaging 0.78
IGL01539:Olfr1226 APN 2 89193492 missense possibly damaging 0.81
IGL01549:Olfr1226 APN 2 89193789 missense probably benign 0.01
IGL02040:Olfr1226 APN 2 89193563 missense probably benign 0.16
IGL02174:Olfr1226 APN 2 89193368 missense probably benign 0.01
IGL02322:Olfr1226 APN 2 89193462 missense probably damaging 0.99
IGL02881:Olfr1226 APN 2 89193641 missense probably damaging 1.00
IGL03336:Olfr1226 APN 2 89193897 missense probably benign 0.16
R1565:Olfr1226 UTSW 2 89193883 missense probably damaging 0.99
R3429:Olfr1226 UTSW 2 89193273 missense probably benign 0.04
R5668:Olfr1226 UTSW 2 89193826 missense possibly damaging 0.60
R6404:Olfr1226 UTSW 2 89193562 missense probably damaging 1.00
R6418:Olfr1226 UTSW 2 89193479 missense probably damaging 0.97
R7863:Olfr1226 UTSW 2 89193951 missense probably benign
R8097:Olfr1226 UTSW 2 89193632 missense probably damaging 1.00
R8544:Olfr1226 UTSW 2 89193968 missense possibly damaging 0.68
R8792:Olfr1226 UTSW 2 89193887 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGATTGTGGCAAATACAAGTGC -3'
(R):5'- ATGACCAGGAGACTCTGTGG -3'

Sequencing Primer
(F):5'- CAGCAGGTCGAGCATATATTAATATG -3'
(R):5'- CCAGGAGACTCTGTGGCATTTTG -3'
Posted On2019-05-13