Incidental Mutation 'R7039:Cyp4a14'
ID 546927
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 045139-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7039 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 115348278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 400 (R400C)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably benign
Transcript: ENSMUST00000030487
AA Change: R400C

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: R400C

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b A T 4: 56,741,022 (GRCm39) L112Q probably damaging Het
Agap3 A C 5: 24,688,399 (GRCm39) I396L probably benign Het
AI987944 G T 7: 41,023,880 (GRCm39) S366R probably benign Het
Aox3 A G 1: 58,215,714 (GRCm39) T1049A probably damaging Het
Ap1g2 A T 14: 55,340,111 (GRCm39) L407* probably null Het
Baiap3 G A 17: 25,462,814 (GRCm39) R1075C probably benign Het
Brd3 T C 2: 27,346,929 (GRCm39) K402E probably damaging Het
Cc2d2b A T 19: 40,790,845 (GRCm39) D935V probably damaging Het
Cenpe A G 3: 134,961,217 (GRCm39) N1904D probably benign Het
Cfap74 G T 4: 155,538,565 (GRCm39) probably null Het
Chrdl2 A G 7: 99,677,879 (GRCm39) T261A probably damaging Het
Dhfr G A 13: 92,491,791 (GRCm39) V9I probably benign Het
Epha4 A G 1: 77,483,422 (GRCm39) S196P probably damaging Het
Evc2 T A 5: 37,579,232 (GRCm39) L1115Q probably damaging Het
Fat3 T A 9: 16,287,561 (GRCm39) E654V probably damaging Het
Fcgbpl1 G A 7: 27,839,573 (GRCm39) R462Q possibly damaging Het
Fer1l4 C T 2: 155,878,650 (GRCm39) V14I probably benign Het
Frmd5 A T 2: 121,378,128 (GRCm39) probably benign Het
Helz T C 11: 107,510,144 (GRCm39) probably null Het
Igkv6-13 T C 6: 70,434,498 (GRCm39) S116G probably benign Het
Iscu T C 5: 113,914,833 (GRCm39) V115A possibly damaging Het
Jade2 C A 11: 51,719,186 (GRCm39) K253N probably damaging Het
Katnal2 A G 18: 77,134,868 (GRCm39) probably null Het
Kif13a C T 13: 46,905,931 (GRCm39) V671M possibly damaging Het
Magi3 T C 3: 103,958,699 (GRCm39) D462G probably damaging Het
Map3k14 T C 11: 103,111,861 (GRCm39) N940S probably damaging Het
Masp2 A T 4: 148,687,043 (GRCm39) M1L probably benign Het
Mga G A 2: 119,763,159 (GRCm39) V1272I probably benign Het
Mib2 T C 4: 155,744,158 (GRCm39) D168G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Msto1 A C 3: 88,818,697 (GRCm39) V287G probably damaging Het
Myo5b T A 18: 74,834,599 (GRCm39) D886E probably benign Het
Nek10 T C 14: 14,826,946 (GRCm38) I48T possibly damaging Het
Nek10 A T 14: 14,986,700 (GRCm38) R1013W probably damaging Het
Nipsnap3a T C 4: 53,000,130 (GRCm39) V194A probably damaging Het
Nlrp9a A T 7: 26,267,367 (GRCm39) T766S probably benign Het
Nol10 T A 12: 17,479,185 (GRCm39) S672T possibly damaging Het
Or4a80 A T 2: 89,583,095 (GRCm39) F26I probably benign Het
Or4c121 A T 2: 89,023,790 (GRCm39) I196N probably damaging Het
Or8d1b T A 9: 38,887,283 (GRCm39) F104I probably damaging Het
Or8j3c A T 2: 86,253,177 (GRCm39) I281K possibly damaging Het
Patj T A 4: 98,457,315 (GRCm39) N1272K probably damaging Het
Peak1 T C 9: 56,165,093 (GRCm39) E945G probably benign Het
Peg3 C T 7: 6,720,858 (GRCm39) D16N probably damaging Het
Pik3r4 T G 9: 105,554,089 (GRCm39) I1082M possibly damaging Het
Plekhg5 T A 4: 152,192,242 (GRCm39) M472K possibly damaging Het
Plekhm1 T C 11: 103,286,054 (GRCm39) D127G probably damaging Het
Ppfia4 G A 1: 134,239,853 (GRCm39) S908L probably damaging Het
Psmc3 A G 2: 90,885,391 (GRCm39) N60S probably benign Het
Rapgef1 T A 2: 29,616,226 (GRCm39) D697E probably damaging Het
Rapgef3 T A 15: 97,659,449 (GRCm39) H54L probably benign Het
Rhobtb3 G A 13: 76,020,572 (GRCm39) R577* probably null Het
Safb2 T C 17: 56,871,594 (GRCm39) E218G possibly damaging Het
Scaf1 C T 7: 44,657,850 (GRCm39) R343H probably damaging Het
Snx24 G A 18: 53,473,307 (GRCm39) probably null Het
Tbc1d1 T C 5: 64,442,100 (GRCm39) F707L probably benign Het
Tcaf2 T C 6: 42,603,074 (GRCm39) T829A probably damaging Het
Tcea2 C T 2: 181,328,711 (GRCm39) Q248* probably null Het
Tcirg1 A T 19: 3,946,666 (GRCm39) L729Q probably damaging Het
Thap3 A G 4: 152,070,149 (GRCm39) F82L probably damaging Het
Ttk T A 9: 83,750,145 (GRCm39) M700K probably damaging Het
Ubap2l G T 3: 89,909,662 (GRCm39) P56H probably damaging Het
Ubr2 A G 17: 47,321,139 (GRCm39) S3P probably benign Het
Uchl3 C T 14: 101,923,128 (GRCm39) probably benign Het
Vmn2r111 T A 17: 22,767,165 (GRCm39) E777D probably damaging Het
Vmn2r20 A T 6: 123,363,082 (GRCm39) D567E probably damaging Het
Vps13c T G 9: 67,845,045 (GRCm39) L2043R probably damaging Het
Zan T G 5: 137,398,396 (GRCm39) D4212A unknown Het
Zap70 C T 1: 36,817,832 (GRCm39) P278S probably benign Het
Zbtb8b A T 4: 129,321,478 (GRCm39) M461K possibly damaging Het
Zfat T G 15: 68,052,211 (GRCm39) I528L probably benign Het
Zfp532 T G 18: 65,771,834 (GRCm39) V784G probably benign Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACGTGACTGCAATTTCAAGTC -3'
(R):5'- CCTCTGTCACATGGTAAGAACC -3'

Sequencing Primer
(F):5'- CCTCTGCTATATAGGCAGCTGAAG -3'
(R):5'- CACTTGTCTTTTTATAGGAGAGACC -3'
Posted On 2019-05-13