Incidental Mutation 'R7039:Plekhg5'
ID546931
Institutional Source Beutler Lab
Gene Symbol Plekhg5
Ensembl Gene ENSMUSG00000039713
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R7039 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location152072498-152115400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152107785 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 472 (M472K)
Ref Sequence ENSEMBL: ENSMUSP00000101286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084115] [ENSMUST00000105661] [ENSMUST00000105662] [ENSMUST00000118648]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084115
AA Change: M472K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081132
Gene: ENSMUSG00000039713
AA Change: M472K

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105661
AA Change: M472K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101286
Gene: ENSMUSG00000039713
AA Change: M472K

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105662
AA Change: M440K

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101287
Gene: ENSMUSG00000039713
AA Change: M440K

DomainStartEndE-ValueType
low complexity region 282 302 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
RhoGEF 378 565 5.21e-53 SMART
PH 623 724 7.35e-12 SMART
low complexity region 746 758 N/A INTRINSIC
low complexity region 863 902 N/A INTRINSIC
low complexity region 1028 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118648
AA Change: M459K

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112707
Gene: ENSMUSG00000039713
AA Change: M459K

DomainStartEndE-ValueType
low complexity region 301 321 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
RhoGEF 397 584 5.21e-53 SMART
PH 642 743 7.35e-12 SMART
low complexity region 765 777 N/A INTRINSIC
low complexity region 882 921 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the Rho guanine exchange factor (GEF) family of proteins, which activate GTPases by replacing GDP with GTP. This family member is a RhoA GEF that plays a role in endothelial cell migration and tube formation. It is required for angiogenesis and may function in neuronal cell differentiation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display angiogenic defects that affect multiple organs, including sparser coronary and kidney arterial systems that appear to deficient in small diameter vessels while the major coronary and kidney arteries remain intact. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,140,148 R462Q possibly damaging Het
Actl7b A T 4: 56,741,022 L112Q probably damaging Het
Agap3 A C 5: 24,483,401 I396L probably benign Het
AI987944 G T 7: 41,374,456 S366R probably benign Het
Aox3 A G 1: 58,176,555 T1049A probably damaging Het
Ap1g2 A T 14: 55,102,654 L407* probably null Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Brd3 T C 2: 27,456,917 K402E probably damaging Het
Cc2d2b A T 19: 40,802,401 D935V probably damaging Het
Cenpe A G 3: 135,255,456 N1904D probably benign Het
Cfap74 G T 4: 155,454,108 probably null Het
Chrdl2 A G 7: 100,028,672 T261A probably damaging Het
Cyp4a14 G A 4: 115,491,081 R400C probably benign Het
Dhfr G A 13: 92,355,283 V9I probably benign Het
Epha4 A G 1: 77,506,785 S196P probably damaging Het
Evc2 T A 5: 37,421,888 L1115Q probably damaging Het
Fat3 T A 9: 16,376,265 E654V probably damaging Het
Fer1l4 C T 2: 156,036,730 V14I probably benign Het
Frmd5 A T 2: 121,547,647 probably benign Het
Helz T C 11: 107,619,318 probably null Het
Igkv6-13 T C 6: 70,457,514 S116G probably benign Het
Iscu T C 5: 113,776,772 V115A possibly damaging Het
Jade2 C A 11: 51,828,359 K253N probably damaging Het
Katnal2 A G 18: 77,047,172 probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Magi3 T C 3: 104,051,383 D462G probably damaging Het
Map3k14 T C 11: 103,221,035 N940S probably damaging Het
Masp2 A T 4: 148,602,586 M1L probably benign Het
Mga G A 2: 119,932,678 V1272I probably benign Het
Mib2 T C 4: 155,659,701 D168G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Msto1 A C 3: 88,911,390 V287G probably damaging Het
Myo5b T A 18: 74,701,528 D886E probably benign Het
Nek10 T C 14: 14,826,946 I48T possibly damaging Het
Nek10 A T 14: 14,986,700 R1013W probably damaging Het
Nipsnap3a T C 4: 53,000,130 V194A probably damaging Het
Nlrp9a A T 7: 26,567,942 T766S probably benign Het
Nol10 T A 12: 17,429,184 S672T possibly damaging Het
Olfr1062 A T 2: 86,422,833 I281K possibly damaging Het
Olfr1226 A T 2: 89,193,446 I196N probably damaging Het
Olfr1253 A T 2: 89,752,751 F26I probably benign Het
Olfr933 T A 9: 38,975,987 F104I probably damaging Het
Patj T A 4: 98,569,078 N1272K probably damaging Het
Peak1 T C 9: 56,257,809 E945G probably benign Het
Peg3 C T 7: 6,717,859 D16N probably damaging Het
Pik3r4 T G 9: 105,676,890 I1082M possibly damaging Het
Plekhm1 T C 11: 103,395,228 D127G probably damaging Het
Ppfia4 G A 1: 134,312,115 S908L probably damaging Het
Psmc3 A G 2: 91,055,046 N60S probably benign Het
Rapgef1 T A 2: 29,726,214 D697E probably damaging Het
Rapgef3 T A 15: 97,761,568 H54L probably benign Het
Rhobtb3 G A 13: 75,872,453 R577* probably null Het
Safb2 T C 17: 56,564,594 E218G possibly damaging Het
Scaf1 C T 7: 45,008,426 R343H probably damaging Het
Snx24 G A 18: 53,340,235 probably null Het
Tbc1d1 T C 5: 64,284,757 F707L probably benign Het
Tcaf2 T C 6: 42,626,140 T829A probably damaging Het
Tcea2 C T 2: 181,686,918 Q248* probably null Het
Tcirg1 A T 19: 3,896,666 L729Q probably damaging Het
Thap3 A G 4: 151,985,692 F82L probably damaging Het
Ttk T A 9: 83,868,092 M700K probably damaging Het
Ubap2l G T 3: 90,002,355 P56H probably damaging Het
Ubr2 A G 17: 47,010,213 S3P probably benign Het
Uchl3 C T 14: 101,685,692 probably benign Het
Vmn2r111 T A 17: 22,548,184 E777D probably damaging Het
Vmn2r20 A T 6: 123,386,123 D567E probably damaging Het
Vps13c T G 9: 67,937,763 L2043R probably damaging Het
Zan T G 5: 137,400,134 D4212A unknown Het
Zap70 C T 1: 36,778,751 P278S probably benign Het
Zbtb8b A T 4: 129,427,685 M461K possibly damaging Het
Zfat T G 15: 68,180,362 I528L probably benign Het
Zfp532 T G 18: 65,638,763 V784G probably benign Het
Other mutations in Plekhg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Plekhg5 APN 4 152102041 splice site probably null
IGL01025:Plekhg5 APN 4 152108526 missense probably damaging 1.00
IGL01062:Plekhg5 APN 4 152108496 missense probably damaging 1.00
IGL01138:Plekhg5 APN 4 152106978 missense probably damaging 1.00
IGL01301:Plekhg5 APN 4 152112553 missense probably benign
IGL02372:Plekhg5 APN 4 152102080 missense probably damaging 0.96
IGL02701:Plekhg5 APN 4 152103022 missense probably damaging 1.00
ANU18:Plekhg5 UTSW 4 152112553 missense probably benign
R0005:Plekhg5 UTSW 4 152112651 small deletion probably benign
R0012:Plekhg5 UTSW 4 152104750 missense probably benign 0.20
R0050:Plekhg5 UTSW 4 152108088 critical splice donor site probably null
R0233:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0233:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0234:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0346:Plekhg5 UTSW 4 152114253 missense probably benign 0.08
R0555:Plekhg5 UTSW 4 152107469 nonsense probably null
R0631:Plekhg5 UTSW 4 152112419 missense possibly damaging 0.89
R0639:Plekhg5 UTSW 4 152114120 missense probably benign 0.19
R1372:Plekhg5 UTSW 4 152104731 missense probably damaging 0.99
R1563:Plekhg5 UTSW 4 152096809 missense probably benign 0.33
R2870:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2870:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2871:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2871:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2872:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2872:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2873:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R3104:Plekhg5 UTSW 4 152112178 missense probably damaging 1.00
R3106:Plekhg5 UTSW 4 152112178 missense probably damaging 1.00
R3408:Plekhg5 UTSW 4 152108292 missense probably damaging 1.00
R4289:Plekhg5 UTSW 4 152112427 missense probably benign 0.05
R5157:Plekhg5 UTSW 4 152107865 splice site probably benign
R5643:Plekhg5 UTSW 4 152104340 missense probably benign 0.14
R5644:Plekhg5 UTSW 4 152104340 missense probably benign 0.14
R5790:Plekhg5 UTSW 4 152113935 missense probably benign
R6770:Plekhg5 UTSW 4 152103079 missense probably benign
R7027:Plekhg5 UTSW 4 152113974 missense probably benign 0.01
R7092:Plekhg5 UTSW 4 152114508 missense probably damaging 1.00
R7309:Plekhg5 UTSW 4 152112528 missense possibly damaging 0.50
R7319:Plekhg5 UTSW 4 152108428 missense probably benign 0.13
R7439:Plekhg5 UTSW 4 152113935 missense probably benign 0.19
R7543:Plekhg5 UTSW 4 152108034 missense probably damaging 1.00
R7662:Plekhg5 UTSW 4 152104298 missense probably damaging 1.00
R8271:Plekhg5 UTSW 4 152103007 missense probably damaging 1.00
R8322:Plekhg5 UTSW 4 152104744 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ACTAAGTACCTGGCCTGGAGTG -3'
(R):5'- CTTGAAGAGTGAGCCGAACTG -3'

Sequencing Primer
(F):5'- TGGAGTGGCAGCGGCAG -3'
(R):5'- GGCAAACAACAGCACCTG -3'
Posted On2019-05-13