Incidental Mutation 'R7039:Mib2'
ID546933
Institutional Source Beutler Lab
Gene Symbol Mib2
Ensembl Gene ENSMUSG00000029060
Gene Namemindbomb E3 ubiquitin protein ligase 2
Synonyms2210008I11Rik, Zzank1
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001256107.1, NM_145124.3, NM_001256108.2; MGI:2679684

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7039 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155654677-155669198 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155659701 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 168 (D168G)
Ref Sequence ENSEMBL: ENSMUSP00000099465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103176] [ENSMUST00000141108]
Predicted Effect probably damaging
Transcript: ENSMUST00000103176
AA Change: D168G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099465
Gene: ENSMUSG00000029060
AA Change: D168G

DomainStartEndE-ValueType
Pfam:MIB_HERC2 12 78 3.4e-26 PFAM
ZnF_ZZ 85 130 6.44e-9 SMART
Pfam:MIB_HERC2 160 225 4.2e-26 PFAM
Blast:ANK 285 320 2e-13 BLAST
ANK 428 457 8.52e-4 SMART
ANK 461 490 6.71e-2 SMART
ANK 494 523 9.93e-5 SMART
ANK 527 559 1.1e2 SMART
ANK 563 593 9.21e0 SMART
ANK 597 627 3.57e-6 SMART
ANK 631 660 3.31e-1 SMART
ANK 664 709 1.73e3 SMART
Blast:ANK 733 762 9e-10 BLAST
low complexity region 763 772 N/A INTRINSIC
RING 798 832 2.55e-1 SMART
RING 877 909 1.81e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139788
Predicted Effect probably benign
Transcript: ENSMUST00000141108
SMART Domains Protein: ENSMUSP00000122269
Gene: ENSMUSG00000029060

DomainStartEndE-ValueType
Pfam:MIB_HERC2 1 52 7.1e-17 PFAM
internal_repeat_1 82 150 7.77e-12 PROSPERO
internal_repeat_1 153 220 7.77e-12 PROSPERO
ANK 289 318 8.52e-4 SMART
ANK 322 351 6.71e-2 SMART
Pfam:Ank 356 375 2.9e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155189
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype Strain: 3652500; 3804450
PHENOTYPE: Mice homozygous for a knock-out allele display exencephaly with a variable penetrance that depends on the genetic background. Mice homozygous for a reporter/null allele are viable, fertile and show normal growth, body weight and brain morphology. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,140,148 R462Q possibly damaging Het
Actl7b A T 4: 56,741,022 L112Q probably damaging Het
Agap3 A C 5: 24,483,401 I396L probably benign Het
AI987944 G T 7: 41,374,456 S366R probably benign Het
Aox3 A G 1: 58,176,555 T1049A probably damaging Het
Ap1g2 A T 14: 55,102,654 L407* probably null Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Brd3 T C 2: 27,456,917 K402E probably damaging Het
Cc2d2b A T 19: 40,802,401 D935V probably damaging Het
Cenpe A G 3: 135,255,456 N1904D probably benign Het
Cfap74 G T 4: 155,454,108 probably null Het
Chrdl2 A G 7: 100,028,672 T261A probably damaging Het
Cyp4a14 G A 4: 115,491,081 R400C probably benign Het
Dhfr G A 13: 92,355,283 V9I probably benign Het
Epha4 A G 1: 77,506,785 S196P probably damaging Het
Evc2 T A 5: 37,421,888 L1115Q probably damaging Het
Fat3 T A 9: 16,376,265 E654V probably damaging Het
Fer1l4 C T 2: 156,036,730 V14I probably benign Het
Frmd5 A T 2: 121,547,647 probably benign Het
Helz T C 11: 107,619,318 probably null Het
Igkv6-13 T C 6: 70,457,514 S116G probably benign Het
Iscu T C 5: 113,776,772 V115A possibly damaging Het
Jade2 C A 11: 51,828,359 K253N probably damaging Het
Katnal2 A G 18: 77,047,172 probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Magi3 T C 3: 104,051,383 D462G probably damaging Het
Map3k14 T C 11: 103,221,035 N940S probably damaging Het
Masp2 A T 4: 148,602,586 M1L probably benign Het
Mga G A 2: 119,932,678 V1272I probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Msto1 A C 3: 88,911,390 V287G probably damaging Het
Myo5b T A 18: 74,701,528 D886E probably benign Het
Nek10 T C 14: 14,826,946 I48T possibly damaging Het
Nek10 A T 14: 14,986,700 R1013W probably damaging Het
Nipsnap3a T C 4: 53,000,130 V194A probably damaging Het
Nlrp9a A T 7: 26,567,942 T766S probably benign Het
Nol10 T A 12: 17,429,184 S672T possibly damaging Het
Olfr1062 A T 2: 86,422,833 I281K possibly damaging Het
Olfr1226 A T 2: 89,193,446 I196N probably damaging Het
Olfr1253 A T 2: 89,752,751 F26I probably benign Het
Olfr933 T A 9: 38,975,987 F104I probably damaging Het
Patj T A 4: 98,569,078 N1272K probably damaging Het
Peak1 T C 9: 56,257,809 E945G probably benign Het
Peg3 C T 7: 6,717,859 D16N probably damaging Het
Pik3r4 T G 9: 105,676,890 I1082M possibly damaging Het
Plekhg5 T A 4: 152,107,785 M472K possibly damaging Het
Plekhm1 T C 11: 103,395,228 D127G probably damaging Het
Ppfia4 G A 1: 134,312,115 S908L probably damaging Het
Psmc3 A G 2: 91,055,046 N60S probably benign Het
Rapgef1 T A 2: 29,726,214 D697E probably damaging Het
Rapgef3 T A 15: 97,761,568 H54L probably benign Het
Rhobtb3 G A 13: 75,872,453 R577* probably null Het
Safb2 T C 17: 56,564,594 E218G possibly damaging Het
Scaf1 C T 7: 45,008,426 R343H probably damaging Het
Snx24 G A 18: 53,340,235 probably null Het
Tbc1d1 T C 5: 64,284,757 F707L probably benign Het
Tcaf2 T C 6: 42,626,140 T829A probably damaging Het
Tcea2 C T 2: 181,686,918 Q248* probably null Het
Tcirg1 A T 19: 3,896,666 L729Q probably damaging Het
Thap3 A G 4: 151,985,692 F82L probably damaging Het
Ttk T A 9: 83,868,092 M700K probably damaging Het
Ubap2l G T 3: 90,002,355 P56H probably damaging Het
Ubr2 A G 17: 47,010,213 S3P probably benign Het
Uchl3 C T 14: 101,685,692 probably benign Het
Vmn2r111 T A 17: 22,548,184 E777D probably damaging Het
Vmn2r20 A T 6: 123,386,123 D567E probably damaging Het
Vps13c T G 9: 67,937,763 L2043R probably damaging Het
Zan T G 5: 137,400,134 D4212A unknown Het
Zap70 C T 1: 36,778,751 P278S probably benign Het
Zbtb8b A T 4: 129,427,685 M461K possibly damaging Het
Zfat T G 15: 68,180,362 I528L probably benign Het
Zfp532 T G 18: 65,638,763 V784G probably benign Het
Other mutations in Mib2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Mib2 APN 4 155657730 missense probably damaging 1.00
IGL01404:Mib2 APN 4 155654936 missense probably damaging 1.00
IGL01819:Mib2 APN 4 155655258 unclassified probably null
IGL02147:Mib2 APN 4 155657687 missense probably benign
IGL02260:Mib2 APN 4 155661171 missense probably damaging 1.00
IGL02472:Mib2 APN 4 155656746 missense probably damaging 1.00
IGL02632:Mib2 APN 4 155655579 missense probably damaging 0.98
IGL03051:Mib2 APN 4 155657290 missense probably damaging 1.00
IGL03077:Mib2 APN 4 155659443 missense probably benign 0.01
R0042:Mib2 UTSW 4 155659440 nonsense probably null
R0042:Mib2 UTSW 4 155659440 nonsense probably null
R0115:Mib2 UTSW 4 155656062 unclassified probably benign
R0193:Mib2 UTSW 4 155655673 missense probably benign
R0279:Mib2 UTSW 4 155661216 missense possibly damaging 0.89
R0373:Mib2 UTSW 4 155656288 missense probably damaging 1.00
R0481:Mib2 UTSW 4 155656062 unclassified probably benign
R0563:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0564:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0625:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0714:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0740:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0942:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R0987:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1023:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1033:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1037:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1460:Mib2 UTSW 4 155659460 missense probably damaging 1.00
R1481:Mib2 UTSW 4 155656999 missense probably benign 0.01
R1712:Mib2 UTSW 4 155654799 missense probably damaging 1.00
R2015:Mib2 UTSW 4 155657880 missense probably damaging 1.00
R2072:Mib2 UTSW 4 155659701 missense probably damaging 0.99
R2131:Mib2 UTSW 4 155655238 unclassified probably null
R2187:Mib2 UTSW 4 155654933 missense possibly damaging 0.95
R3751:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R3752:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R3753:Mib2 UTSW 4 155655284 missense probably damaging 1.00
R4381:Mib2 UTSW 4 155657612 missense possibly damaging 0.55
R4584:Mib2 UTSW 4 155657287 missense probably damaging 1.00
R4669:Mib2 UTSW 4 155657415 missense possibly damaging 0.49
R4754:Mib2 UTSW 4 155655365 missense possibly damaging 0.90
R4782:Mib2 UTSW 4 155659772 missense probably benign 0.00
R4799:Mib2 UTSW 4 155659772 missense probably benign 0.00
R5036:Mib2 UTSW 4 155656288 missense probably damaging 1.00
R5073:Mib2 UTSW 4 155656776 missense probably damaging 1.00
R5915:Mib2 UTSW 4 155656051 unclassified probably benign
R6695:Mib2 UTSW 4 155661172 missense probably damaging 1.00
R7234:Mib2 UTSW 4 155657893 missense probably damaging 1.00
R7582:Mib2 UTSW 4 155654810 missense probably benign
X0012:Mib2 UTSW 4 155655395 unclassified probably null
Z1176:Mib2 UTSW 4 155661141 missense probably benign 0.06
Z1177:Mib2 UTSW 4 155655521 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACGTTCGTGGTTCCATCTG -3'
(R):5'- TCCTAATGACCCAGATGCCG -3'

Sequencing Primer
(F):5'- GTCACACTGGCCACACTTCG -3'
(R):5'- CTAATGACCCAGATGCCGTTAGG -3'
Posted On2019-05-13