Incidental Mutation 'R7039:Tcaf2'
ID546939
Institutional Source Beutler Lab
Gene Symbol Tcaf2
Ensembl Gene ENSMUSG00000029851
Gene NameTRPM8 channel-associated factor 2
SynonymsFam115c
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_146174.1; MGI:2385258

Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7039 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location42623016-42645254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42626140 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 829 (T829A)
Ref Sequence ENSEMBL: ENSMUSP00000031879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031879]
Predicted Effect probably damaging
Transcript: ENSMUST00000031879
AA Change: T829A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031879
Gene: ENSMUSG00000029851
AA Change: T829A

DomainStartEndE-ValueType
low complexity region 515 526 N/A INTRINSIC
M60-like 543 842 4.85e-138 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,140,148 R462Q possibly damaging Het
Actl7b A T 4: 56,741,022 L112Q probably damaging Het
Agap3 A C 5: 24,483,401 I396L probably benign Het
AI987944 G T 7: 41,374,456 S366R probably benign Het
Aox3 A G 1: 58,176,555 T1049A probably damaging Het
Ap1g2 A T 14: 55,102,654 L407* probably null Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Brd3 T C 2: 27,456,917 K402E probably damaging Het
Cc2d2b A T 19: 40,802,401 D935V probably damaging Het
Cenpe A G 3: 135,255,456 N1904D probably benign Het
Cfap74 G T 4: 155,454,108 probably null Het
Chrdl2 A G 7: 100,028,672 T261A probably damaging Het
Cyp4a14 G A 4: 115,491,081 R400C probably benign Het
Dhfr G A 13: 92,355,283 V9I probably benign Het
Epha4 A G 1: 77,506,785 S196P probably damaging Het
Evc2 T A 5: 37,421,888 L1115Q probably damaging Het
Fat3 T A 9: 16,376,265 E654V probably damaging Het
Fer1l4 C T 2: 156,036,730 V14I probably benign Het
Frmd5 A T 2: 121,547,647 probably benign Het
Helz T C 11: 107,619,318 probably null Het
Igkv6-13 T C 6: 70,457,514 S116G probably benign Het
Iscu T C 5: 113,776,772 V115A possibly damaging Het
Jade2 C A 11: 51,828,359 K253N probably damaging Het
Katnal2 A G 18: 77,047,172 probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Magi3 T C 3: 104,051,383 D462G probably damaging Het
Map3k14 T C 11: 103,221,035 N940S probably damaging Het
Masp2 A T 4: 148,602,586 M1L probably benign Het
Mga G A 2: 119,932,678 V1272I probably benign Het
Mib2 T C 4: 155,659,701 D168G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Msto1 A C 3: 88,911,390 V287G probably damaging Het
Myo5b T A 18: 74,701,528 D886E probably benign Het
Nek10 T C 14: 14,826,946 I48T possibly damaging Het
Nek10 A T 14: 14,986,700 R1013W probably damaging Het
Nipsnap3a T C 4: 53,000,130 V194A probably damaging Het
Nlrp9a A T 7: 26,567,942 T766S probably benign Het
Nol10 T A 12: 17,429,184 S672T possibly damaging Het
Olfr1062 A T 2: 86,422,833 I281K possibly damaging Het
Olfr1226 A T 2: 89,193,446 I196N probably damaging Het
Olfr1253 A T 2: 89,752,751 F26I probably benign Het
Olfr933 T A 9: 38,975,987 F104I probably damaging Het
Patj T A 4: 98,569,078 N1272K probably damaging Het
Peak1 T C 9: 56,257,809 E945G probably benign Het
Peg3 C T 7: 6,717,859 D16N probably damaging Het
Pik3r4 T G 9: 105,676,890 I1082M possibly damaging Het
Plekhg5 T A 4: 152,107,785 M472K possibly damaging Het
Plekhm1 T C 11: 103,395,228 D127G probably damaging Het
Ppfia4 G A 1: 134,312,115 S908L probably damaging Het
Psmc3 A G 2: 91,055,046 N60S probably benign Het
Rapgef1 T A 2: 29,726,214 D697E probably damaging Het
Rapgef3 T A 15: 97,761,568 H54L probably benign Het
Rhobtb3 G A 13: 75,872,453 R577* probably null Het
Safb2 T C 17: 56,564,594 E218G possibly damaging Het
Scaf1 C T 7: 45,008,426 R343H probably damaging Het
Snx24 G A 18: 53,340,235 probably null Het
Tbc1d1 T C 5: 64,284,757 F707L probably benign Het
Tcea2 C T 2: 181,686,918 Q248* probably null Het
Tcirg1 A T 19: 3,896,666 L729Q probably damaging Het
Thap3 A G 4: 151,985,692 F82L probably damaging Het
Ttk T A 9: 83,868,092 M700K probably damaging Het
Ubap2l G T 3: 90,002,355 P56H probably damaging Het
Ubr2 A G 17: 47,010,213 S3P probably benign Het
Uchl3 C T 14: 101,685,692 probably benign Het
Vmn2r111 T A 17: 22,548,184 E777D probably damaging Het
Vmn2r20 A T 6: 123,386,123 D567E probably damaging Het
Vps13c T G 9: 67,937,763 L2043R probably damaging Het
Zan T G 5: 137,400,134 D4212A unknown Het
Zap70 C T 1: 36,778,751 P278S probably benign Het
Zbtb8b A T 4: 129,427,685 M461K possibly damaging Het
Zfat T G 15: 68,180,362 I528L probably benign Het
Zfp532 T G 18: 65,638,763 V784G probably benign Het
Other mutations in Tcaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tcaf2 APN 6 42630036 nonsense probably null
IGL00909:Tcaf2 APN 6 42624576 missense probably damaging 1.00
IGL01448:Tcaf2 APN 6 42630328 missense probably benign 0.05
IGL01870:Tcaf2 APN 6 42624477 missense possibly damaging 0.47
IGL02133:Tcaf2 APN 6 42627396 missense probably benign 0.06
IGL02208:Tcaf2 APN 6 42629086 missense probably damaging 1.00
IGL02666:Tcaf2 APN 6 42629124 splice site probably benign
PIT4260001:Tcaf2 UTSW 6 42642805 missense probably damaging 0.97
PIT4382001:Tcaf2 UTSW 6 42624366 makesense probably null
R0029:Tcaf2 UTSW 6 42630159 nonsense probably null
R0029:Tcaf2 UTSW 6 42630159 nonsense probably null
R0047:Tcaf2 UTSW 6 42629613 missense probably benign
R0047:Tcaf2 UTSW 6 42629613 missense probably benign
R0255:Tcaf2 UTSW 6 42642904 missense possibly damaging 0.95
R0617:Tcaf2 UTSW 6 42642511 missense probably damaging 0.97
R1387:Tcaf2 UTSW 6 42624578 missense probably damaging 1.00
R1523:Tcaf2 UTSW 6 42624451 nonsense probably null
R1529:Tcaf2 UTSW 6 42629506 missense probably benign 0.03
R1698:Tcaf2 UTSW 6 42628017 nonsense probably null
R1992:Tcaf2 UTSW 6 42629857 missense probably benign
R2065:Tcaf2 UTSW 6 42628047 missense probably benign 0.12
R2144:Tcaf2 UTSW 6 42642804 missense probably benign 0.45
R2435:Tcaf2 UTSW 6 42630364 missense possibly damaging 0.72
R2519:Tcaf2 UTSW 6 42629431 missense possibly damaging 0.92
R3979:Tcaf2 UTSW 6 42642547 missense probably damaging 1.00
R4093:Tcaf2 UTSW 6 42642838 missense probably damaging 1.00
R4532:Tcaf2 UTSW 6 42626437 missense probably damaging 1.00
R4780:Tcaf2 UTSW 6 42628062 missense probably damaging 1.00
R4906:Tcaf2 UTSW 6 42629745 missense probably benign 0.02
R4993:Tcaf2 UTSW 6 42642640 missense probably damaging 1.00
R5076:Tcaf2 UTSW 6 42629467 missense probably benign 0.16
R5643:Tcaf2 UTSW 6 42642773 missense possibly damaging 0.85
R5644:Tcaf2 UTSW 6 42642773 missense possibly damaging 0.85
R5975:Tcaf2 UTSW 6 42642778 missense probably benign 0.22
R6234:Tcaf2 UTSW 6 42630374 missense probably benign
R6269:Tcaf2 UTSW 6 42627408 missense probably damaging 1.00
R6276:Tcaf2 UTSW 6 42629753 missense probably benign 0.04
R6375:Tcaf2 UTSW 6 42626178 missense probably damaging 0.99
R6523:Tcaf2 UTSW 6 42643019 missense probably benign 0.01
R6825:Tcaf2 UTSW 6 42629518 missense probably benign 0.05
R7099:Tcaf2 UTSW 6 42630341 missense probably benign 0.02
R7284:Tcaf2 UTSW 6 42629538 missense probably damaging 1.00
R7822:Tcaf2 UTSW 6 42629099 missense possibly damaging 0.95
R7964:Tcaf2 UTSW 6 42629706 missense probably benign
R8270:Tcaf2 UTSW 6 42630024 missense probably benign 0.30
R8505:Tcaf2 UTSW 6 42629541 missense probably benign 0.18
Y4339:Tcaf2 UTSW 6 42629472 missense probably benign
Y4341:Tcaf2 UTSW 6 42629472 missense probably benign
Z1177:Tcaf2 UTSW 6 42629616 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCGTAGACATACCACCAGTG -3'
(R):5'- GCAAGAGCTAGTCAGTTTGGC -3'

Sequencing Primer
(F):5'- GTGATCCACACCCAGAAATGG -3'
(R):5'- ATGAGCTGGGCCACAATC -3'
Posted On2019-05-13