Incidental Mutation 'R7039:9530053A07Rik'
ID 546944
Institutional Source Beutler Lab
Gene Symbol 9530053A07Rik
Ensembl Gene ENSMUSG00000078776
Gene Name RIKEN cDNA 9530053A07 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R7039 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 28129466-28164811 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 28140148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 462 (R462Q)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
AlphaFold E9PVG8
Predicted Effect possibly damaging
Transcript: ENSMUST00000059886
AA Change: R462Q

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: R462Q

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150948
AA Change: R462Q

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: R462Q

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b A T 4: 56,741,022 L112Q probably damaging Het
Agap3 A C 5: 24,483,401 I396L probably benign Het
AI987944 G T 7: 41,374,456 S366R probably benign Het
Aox3 A G 1: 58,176,555 T1049A probably damaging Het
Ap1g2 A T 14: 55,102,654 L407* probably null Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Brd3 T C 2: 27,456,917 K402E probably damaging Het
Cc2d2b A T 19: 40,802,401 D935V probably damaging Het
Cenpe A G 3: 135,255,456 N1904D probably benign Het
Cfap74 G T 4: 155,454,108 probably null Het
Chrdl2 A G 7: 100,028,672 T261A probably damaging Het
Cyp4a14 G A 4: 115,491,081 R400C probably benign Het
Dhfr G A 13: 92,355,283 V9I probably benign Het
Epha4 A G 1: 77,506,785 S196P probably damaging Het
Evc2 T A 5: 37,421,888 L1115Q probably damaging Het
Fat3 T A 9: 16,376,265 E654V probably damaging Het
Fer1l4 C T 2: 156,036,730 V14I probably benign Het
Frmd5 A T 2: 121,547,647 probably benign Het
Helz T C 11: 107,619,318 probably null Het
Igkv6-13 T C 6: 70,457,514 S116G probably benign Het
Iscu T C 5: 113,776,772 V115A possibly damaging Het
Jade2 C A 11: 51,828,359 K253N probably damaging Het
Katnal2 A G 18: 77,047,172 probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Magi3 T C 3: 104,051,383 D462G probably damaging Het
Map3k14 T C 11: 103,221,035 N940S probably damaging Het
Masp2 A T 4: 148,602,586 M1L probably benign Het
Mga G A 2: 119,932,678 V1272I probably benign Het
Mib2 T C 4: 155,659,701 D168G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Msto1 A C 3: 88,911,390 V287G probably damaging Het
Myo5b T A 18: 74,701,528 D886E probably benign Het
Nek10 A T 14: 14,986,700 R1013W probably damaging Het
Nek10 T C 14: 14,826,946 I48T possibly damaging Het
Nipsnap3a T C 4: 53,000,130 V194A probably damaging Het
Nlrp9a A T 7: 26,567,942 T766S probably benign Het
Nol10 T A 12: 17,429,184 S672T possibly damaging Het
Olfr1062 A T 2: 86,422,833 I281K possibly damaging Het
Olfr1226 A T 2: 89,193,446 I196N probably damaging Het
Olfr1253 A T 2: 89,752,751 F26I probably benign Het
Olfr933 T A 9: 38,975,987 F104I probably damaging Het
Patj T A 4: 98,569,078 N1272K probably damaging Het
Peak1 T C 9: 56,257,809 E945G probably benign Het
Peg3 C T 7: 6,717,859 D16N probably damaging Het
Pik3r4 T G 9: 105,676,890 I1082M possibly damaging Het
Plekhg5 T A 4: 152,107,785 M472K possibly damaging Het
Plekhm1 T C 11: 103,395,228 D127G probably damaging Het
Ppfia4 G A 1: 134,312,115 S908L probably damaging Het
Psmc3 A G 2: 91,055,046 N60S probably benign Het
Rapgef1 T A 2: 29,726,214 D697E probably damaging Het
Rapgef3 T A 15: 97,761,568 H54L probably benign Het
Rhobtb3 G A 13: 75,872,453 R577* probably null Het
Safb2 T C 17: 56,564,594 E218G possibly damaging Het
Scaf1 C T 7: 45,008,426 R343H probably damaging Het
Snx24 G A 18: 53,340,235 probably null Het
Tbc1d1 T C 5: 64,284,757 F707L probably benign Het
Tcaf2 T C 6: 42,626,140 T829A probably damaging Het
Tcea2 C T 2: 181,686,918 Q248* probably null Het
Tcirg1 A T 19: 3,896,666 L729Q probably damaging Het
Thap3 A G 4: 151,985,692 F82L probably damaging Het
Ttk T A 9: 83,868,092 M700K probably damaging Het
Ubap2l G T 3: 90,002,355 P56H probably damaging Het
Ubr2 A G 17: 47,010,213 S3P probably benign Het
Uchl3 C T 14: 101,685,692 probably benign Het
Vmn2r111 T A 17: 22,548,184 E777D probably damaging Het
Vmn2r20 A T 6: 123,386,123 D567E probably damaging Het
Vps13c T G 9: 67,937,763 L2043R probably damaging Het
Zan T G 5: 137,400,134 D4212A unknown Het
Zap70 C T 1: 36,778,751 P278S probably benign Het
Zbtb8b A T 4: 129,427,685 M461K possibly damaging Het
Zfat T G 15: 68,180,362 I528L probably benign Het
Zfp532 T G 18: 65,638,763 V784G probably benign Het
Other mutations in 9530053A07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:9530053A07Rik APN 7 28164528 missense probably damaging 1.00
IGL00757:9530053A07Rik APN 7 28154445 missense probably damaging 1.00
IGL01015:9530053A07Rik APN 7 28155318 missense probably damaging 1.00
IGL01079:9530053A07Rik APN 7 28139778 missense probably damaging 0.99
IGL01343:9530053A07Rik APN 7 28150702 missense probably benign 0.19
IGL01420:9530053A07Rik APN 7 28140133 missense probably benign 0.28
IGL01604:9530053A07Rik APN 7 28155324 missense probably benign 0.11
IGL01666:9530053A07Rik APN 7 28153292 missense probably damaging 1.00
IGL02002:9530053A07Rik APN 7 28152796 missense probably damaging 1.00
IGL02036:9530053A07Rik APN 7 28137525 missense possibly damaging 0.82
IGL02126:9530053A07Rik APN 7 28139856 missense probably damaging 1.00
IGL02150:9530053A07Rik APN 7 28146779 nonsense probably null
IGL02219:9530053A07Rik APN 7 28154635 missense probably damaging 1.00
IGL02563:9530053A07Rik APN 7 28157892 missense probably benign
IGL02804:9530053A07Rik APN 7 28153370 missense probably benign 0.00
IGL02830:9530053A07Rik APN 7 28162923 missense probably damaging 1.00
IGL02943:9530053A07Rik APN 7 28147188 missense probably damaging 1.00
IGL02977:9530053A07Rik APN 7 28164372 missense possibly damaging 0.83
IGL03231:9530053A07Rik APN 7 28153722 missense possibly damaging 0.95
IGL03304:9530053A07Rik APN 7 28142242 missense probably damaging 0.99
herz UTSW 7 28153839 missense possibly damaging 0.72
pulse UTSW 7 28153749 missense probably damaging 1.00
Sinusoidal UTSW 7 28140130 missense probably damaging 1.00
PIT4378001:9530053A07Rik UTSW 7 28154464 missense possibly damaging 0.61
R0023:9530053A07Rik UTSW 7 28153412 missense probably benign 0.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0131:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0132:9530053A07Rik UTSW 7 28137615 missense probably damaging 1.00
R0158:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R0230:9530053A07Rik UTSW 7 28156825 missense probably damaging 1.00
R0310:9530053A07Rik UTSW 7 28142274 missense probably benign 0.04
R0448:9530053A07Rik UTSW 7 28140235 missense probably benign 0.03
R0462:9530053A07Rik UTSW 7 28137340 missense probably damaging 1.00
R0481:9530053A07Rik UTSW 7 28153749 missense probably damaging 1.00
R0497:9530053A07Rik UTSW 7 28147465 missense probably damaging 1.00
R0556:9530053A07Rik UTSW 7 28159378 missense probably benign
R0562:9530053A07Rik UTSW 7 28162690 missense probably benign 0.30
R0586:9530053A07Rik UTSW 7 28137091 missense probably damaging 0.99
R0924:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R0930:9530053A07Rik UTSW 7 28140130 missense probably damaging 1.00
R1103:9530053A07Rik UTSW 7 28154520 missense probably damaging 1.00
R1213:9530053A07Rik UTSW 7 28157673 missense probably damaging 1.00
R1292:9530053A07Rik UTSW 7 28142794 splice site probably benign
R1368:9530053A07Rik UTSW 7 28159478 missense possibly damaging 0.89
R1451:9530053A07Rik UTSW 7 28137157 missense probably damaging 1.00
R1477:9530053A07Rik UTSW 7 28157093 missense probably benign 0.01
R1538:9530053A07Rik UTSW 7 28155492 missense probably damaging 1.00
R1655:9530053A07Rik UTSW 7 28147110 missense probably damaging 0.98
R1697:9530053A07Rik UTSW 7 28154347 missense probably damaging 1.00
R1741:9530053A07Rik UTSW 7 28157854 missense probably damaging 0.98
R1796:9530053A07Rik UTSW 7 28155372 missense probably damaging 1.00
R1853:9530053A07Rik UTSW 7 28155546 nonsense probably null
R1861:9530053A07Rik UTSW 7 28154732 missense probably damaging 1.00
R1909:9530053A07Rik UTSW 7 28144348 missense possibly damaging 0.52
R1971:9530053A07Rik UTSW 7 28131512 missense possibly damaging 0.90
R1990:9530053A07Rik UTSW 7 28154360 missense probably damaging 0.98
R2020:9530053A07Rik UTSW 7 28155594 missense probably benign
R2084:9530053A07Rik UTSW 7 28157535 missense probably damaging 1.00
R2125:9530053A07Rik UTSW 7 28158022 missense probably benign 0.00
R2132:9530053A07Rik UTSW 7 28155474 missense probably damaging 1.00
R2513:9530053A07Rik UTSW 7 28131635 missense probably damaging 0.99
R2913:9530053A07Rik UTSW 7 28164307 missense probably damaging 1.00
R3150:9530053A07Rik UTSW 7 28154195 missense probably benign 0.21
R3499:9530053A07Rik UTSW 7 28154555 missense probably benign 0.42
R3702:9530053A07Rik UTSW 7 28157778 missense probably damaging 1.00
R3881:9530053A07Rik UTSW 7 28140038 nonsense probably null
R3938:9530053A07Rik UTSW 7 28154294 missense probably damaging 1.00
R4050:9530053A07Rik UTSW 7 28152985 missense possibly damaging 0.55
R4152:9530053A07Rik UTSW 7 28156897 missense possibly damaging 0.47
R4168:9530053A07Rik UTSW 7 28137109 missense probably benign 0.05
R4235:9530053A07Rik UTSW 7 28156648 missense probably damaging 0.99
R4241:9530053A07Rik UTSW 7 28154335 missense probably damaging 1.00
R4363:9530053A07Rik UTSW 7 28146906 missense probably damaging 1.00
R4460:9530053A07Rik UTSW 7 28152856 missense probably benign 0.17
R4463:9530053A07Rik UTSW 7 28150719 missense probably benign
R4841:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4842:9530053A07Rik UTSW 7 28150722 missense probably damaging 1.00
R4876:9530053A07Rik UTSW 7 28142800 intron probably benign
R4905:9530053A07Rik UTSW 7 28156983 missense possibly damaging 0.93
R4997:9530053A07Rik UTSW 7 28143924 missense possibly damaging 0.77
R5091:9530053A07Rik UTSW 7 28156958 missense probably benign 0.44
R5159:9530053A07Rik UTSW 7 28153308 missense probably benign 0.09
R5326:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5396:9530053A07Rik UTSW 7 28140183 missense probably benign
R5441:9530053A07Rik UTSW 7 28156914 missense probably damaging 1.00
R5480:9530053A07Rik UTSW 7 28157999 nonsense probably null
R5542:9530053A07Rik UTSW 7 28155489 missense probably damaging 0.98
R5571:9530053A07Rik UTSW 7 28156569 missense probably damaging 0.99
R5613:9530053A07Rik UTSW 7 28142878 intron probably benign
R5637:9530053A07Rik UTSW 7 28152852 missense probably benign 0.00
R5766:9530053A07Rik UTSW 7 28137329 nonsense probably null
R6174:9530053A07Rik UTSW 7 28139959 missense probably damaging 0.96
R6233:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R6250:9530053A07Rik UTSW 7 28150714 missense probably damaging 1.00
R6379:9530053A07Rik UTSW 7 28157592 missense probably damaging 1.00
R6442:9530053A07Rik UTSW 7 28144186 missense possibly damaging 0.88
R6478:9530053A07Rik UTSW 7 28155373 missense probably damaging 1.00
R6699:9530053A07Rik UTSW 7 28144368 missense probably damaging 1.00
R6852:9530053A07Rik UTSW 7 28147135 missense probably damaging 1.00
R6883:9530053A07Rik UTSW 7 28152835 missense possibly damaging 0.89
R6902:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6903:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6904:9530053A07Rik UTSW 7 28137213 missense probably damaging 1.00
R6992:9530053A07Rik UTSW 7 28140183 missense probably benign 0.04
R7023:9530053A07Rik UTSW 7 28140038 nonsense probably null
R7171:9530053A07Rik UTSW 7 28154519 nonsense probably null
R7282:9530053A07Rik UTSW 7 28144408 missense probably benign 0.02
R7291:9530053A07Rik UTSW 7 28140220 missense probably benign
R7344:9530053A07Rik UTSW 7 28140279 missense possibly damaging 0.79
R7344:9530053A07Rik UTSW 7 28152760 missense possibly damaging 0.46
R7392:9530053A07Rik UTSW 7 28164372 missense possibly damaging 0.83
R7531:9530053A07Rik UTSW 7 28140231 missense probably benign
R7541:9530053A07Rik UTSW 7 28144256 nonsense probably null
R7577:9530053A07Rik UTSW 7 28154423 missense possibly damaging 0.65
R7594:9530053A07Rik UTSW 7 28131460 missense probably damaging 0.99
R7647:9530053A07Rik UTSW 7 28140045 missense probably benign 0.00
R7718:9530053A07Rik UTSW 7 28147201 missense probably damaging 1.00
R7733:9530053A07Rik UTSW 7 28139965 missense probably damaging 1.00
R7737:9530053A07Rik UTSW 7 28157073 missense probably damaging 1.00
R7908:9530053A07Rik UTSW 7 28147496 missense probably benign 0.12
R8013:9530053A07Rik UTSW 7 28137541 missense probably benign 0.14
R8014:9530053A07Rik UTSW 7 28137541 missense probably benign 0.14
R8151:9530053A07Rik UTSW 7 28153341 missense possibly damaging 0.95
R8175:9530053A07Rik UTSW 7 28164448 nonsense probably null
R8254:9530053A07Rik UTSW 7 28147349 missense possibly damaging 0.63
R8345:9530053A07Rik UTSW 7 28155360 missense probably damaging 1.00
R8414:9530053A07Rik UTSW 7 28142733 missense probably damaging 1.00
R8419:9530053A07Rik UTSW 7 28143921 missense probably damaging 1.00
R8496:9530053A07Rik UTSW 7 28143952 missense possibly damaging 0.81
R8691:9530053A07Rik UTSW 7 28153839 missense possibly damaging 0.72
R8785:9530053A07Rik UTSW 7 28154707 missense probably damaging 1.00
R8863:9530053A07Rik UTSW 7 28131581 missense probably damaging 1.00
R8926:9530053A07Rik UTSW 7 28154444 missense probably damaging 1.00
R8950:9530053A07Rik UTSW 7 28164326 missense probably benign 0.32
R9014:9530053A07Rik UTSW 7 28155451 missense probably damaging 1.00
R9045:9530053A07Rik UTSW 7 28154431 missense probably damaging 1.00
R9115:9530053A07Rik UTSW 7 28154329 missense possibly damaging 0.74
R9233:9530053A07Rik UTSW 7 28140094 missense possibly damaging 0.83
R9330:9530053A07Rik UTSW 7 28156985 missense probably benign 0.02
R9426:9530053A07Rik UTSW 7 28143856 missense possibly damaging 0.92
Z1176:9530053A07Rik UTSW 7 28142386 missense probably benign 0.06
Z1176:9530053A07Rik UTSW 7 28154762 missense probably benign 0.03
Z1177:9530053A07Rik UTSW 7 28139898 missense probably benign 0.25
Z1186:9530053A07Rik UTSW 7 28131572 missense probably benign
Z1186:9530053A07Rik UTSW 7 28146705 missense probably benign 0.00
Z1186:9530053A07Rik UTSW 7 28156986 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCCAGGTCAAGAAGTGTAC -3'
(R):5'- TCACCAGCACTTTGCCTTGG -3'

Sequencing Primer
(F):5'- TGTACGCGGACGAAAAATGCC -3'
(R):5'- TTGGTATTCCCGGCGCAC -3'
Posted On 2019-05-13