Mutagenetix > Incidental Mutation

Incidental Mutation 'R7039:9530053A07Rik'

546944

Institutional Source

Beutler Lab

Gene Symbol

9530053A07Rik

Ensembl Gene

ENSMUSG00000078776

Gene Name

RIKEN cDNA 9530053A07 gene

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R7039 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

28129466-28164811 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 28140148 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 462 (R462Q)

Ref Sequence

ENSEMBL: ENSMUSP00000114986 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]

AlphaFold

E9PVG8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000059886
AA Change: R462Q

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: R462Q

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
FOLN	27	49	1.23e-4	SMART
VWD	46	211	1.5e-40	SMART
C8	251	326	4.31e-33	SMART
Pfam:TIL	329	383	2e-13	PFAM
VWC	385	448	1.02e0	SMART
VWD	439	603	4.32e-32	SMART
C8	640	715	4.54e-9	SMART
Pfam:TIL	718	771	1.6e-12	PFAM
VWC	773	826	1.1e0	SMART
FOLN	805	827	6.87e1	SMART
VWD	825	988	7.92e-40	SMART
C8	1033	1108	5.1e-35	SMART
Pfam:TIL	1111	1164	7.6e-11	PFAM
VWC	1166	1224	1.1e-2	SMART
FOLN	1197	1219	9.55e-1	SMART
FOLN	1223	1245	5.38e1	SMART
VWD	1241	1410	9.04e-35	SMART
C8	1450	1526	9.54e-26	SMART
low complexity region	1540	1550	N/A	INTRINSIC
EGF_like	1557	1580	5.34e1	SMART
VWC	1588	1681	3.21e-3	SMART
VWD	1639	1806	7.3e-30	SMART
C8	1838	1913	2.44e-32	SMART
EGF_like	1941	1964	4.46e1	SMART
VWC	1971	2062	2.85e-1	SMART
VWD	2022	2178	1.32e-27	SMART
low complexity region	2199	2212	N/A	INTRINSIC
C8	2219	2294	1.43e-29	SMART
Pfam:TIL	2297	2350	1.1e-11	PFAM
FOLN	2383	2405	5.68e1	SMART
VWD	2402	2564	4.58e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000150948
AA Change: R462Q

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: R462Q

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
FOLN	27	49	1.23e-4	SMART
VWD	46	211	1.5e-40	SMART
C8	251	326	4.31e-33	SMART
Pfam:TIL	329	383	2e-13	PFAM
VWC	385	448	1.02e0	SMART
VWD	439	603	4.32e-32	SMART
C8	640	715	4.54e-9	SMART
Pfam:TIL	718	771	1.6e-12	PFAM
VWC	773	826	1.1e0	SMART
FOLN	805	827	6.87e1	SMART
VWD	825	988	7.92e-40	SMART
C8	1033	1108	5.1e-35	SMART
Pfam:TIL	1111	1164	7.6e-11	PFAM
VWC	1166	1224	1.1e-2	SMART
FOLN	1197	1219	9.55e-1	SMART
FOLN	1223	1245	5.38e1	SMART
VWD	1241	1410	9.04e-35	SMART
C8	1450	1526	9.54e-26	SMART
low complexity region	1540	1550	N/A	INTRINSIC
EGF_like	1557	1580	5.34e1	SMART
VWC	1588	1681	3.21e-3	SMART
VWD	1639	1806	7.3e-30	SMART
C8	1838	1913	2.44e-32	SMART
EGF_like	1941	1964	4.46e1	SMART
VWC	1971	2062	2.85e-1	SMART
VWD	2022	2178	1.32e-27	SMART
low complexity region	2199	2212	N/A	INTRINSIC
C8	2219	2294	1.43e-29	SMART
Pfam:TIL	2297	2350	1.1e-11	PFAM
FOLN	2383	2405	5.68e1	SMART
VWD	2402	2564	4.58e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl7b	A	T	4: 56,741,022	L112Q	probably damaging	Het
Agap3	A	C	5: 24,483,401	I396L	probably benign	Het
AI987944	G	T	7: 41,374,456	S366R	probably benign	Het
Aox3	A	G	1: 58,176,555	T1049A	probably damaging	Het
Ap1g2	A	T	14: 55,102,654	L407*	probably null	Het
Baiap3	G	A	17: 25,243,840	R1075C	probably benign	Het
Brd3	T	C	2: 27,456,917	K402E	probably damaging	Het
Cc2d2b	A	T	19: 40,802,401	D935V	probably damaging	Het
Cenpe	A	G	3: 135,255,456	N1904D	probably benign	Het
Cfap74	G	T	4: 155,454,108		probably null	Het
Chrdl2	A	G	7: 100,028,672	T261A	probably damaging	Het
Cyp4a14	G	A	4: 115,491,081	R400C	probably benign	Het
Dhfr	G	A	13: 92,355,283	V9I	probably benign	Het
Epha4	A	G	1: 77,506,785	S196P	probably damaging	Het
Evc2	T	A	5: 37,421,888	L1115Q	probably damaging	Het
Fat3	T	A	9: 16,376,265	E654V	probably damaging	Het
Fer1l4	C	T	2: 156,036,730	V14I	probably benign	Het
Frmd5	A	T	2: 121,547,647		probably benign	Het
Helz	T	C	11: 107,619,318		probably null	Het
Igkv6-13	T	C	6: 70,457,514	S116G	probably benign	Het
Iscu	T	C	5: 113,776,772	V115A	possibly damaging	Het
Jade2	C	A	11: 51,828,359	K253N	probably damaging	Het
Katnal2	A	G	18: 77,047,172		probably null	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Magi3	T	C	3: 104,051,383	D462G	probably damaging	Het
Map3k14	T	C	11: 103,221,035	N940S	probably damaging	Het
Masp2	A	T	4: 148,602,586	M1L	probably benign	Het
Mga	G	A	2: 119,932,678	V1272I	probably benign	Het
Mib2	T	C	4: 155,659,701	D168G	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Msto1	A	C	3: 88,911,390	V287G	probably damaging	Het
Myo5b	T	A	18: 74,701,528	D886E	probably benign	Het
Nek10	T	C	14: 14,826,946	I48T	possibly damaging	Het
Nek10	A	T	14: 14,986,700	R1013W	probably damaging	Het
Nipsnap3a	T	C	4: 53,000,130	V194A	probably damaging	Het
Nlrp9a	A	T	7: 26,567,942	T766S	probably benign	Het
Nol10	T	A	12: 17,429,184	S672T	possibly damaging	Het
Olfr1062	A	T	2: 86,422,833	I281K	possibly damaging	Het
Olfr1226	A	T	2: 89,193,446	I196N	probably damaging	Het
Olfr1253	A	T	2: 89,752,751	F26I	probably benign	Het
Olfr933	T	A	9: 38,975,987	F104I	probably damaging	Het
Patj	T	A	4: 98,569,078	N1272K	probably damaging	Het
Peak1	T	C	9: 56,257,809	E945G	probably benign	Het
Peg3	C	T	7: 6,717,859	D16N	probably damaging	Het
Pik3r4	T	G	9: 105,676,890	I1082M	possibly damaging	Het
Plekhg5	T	A	4: 152,107,785	M472K	possibly damaging	Het
Plekhm1	T	C	11: 103,395,228	D127G	probably damaging	Het
Ppfia4	G	A	1: 134,312,115	S908L	probably damaging	Het
Psmc3	A	G	2: 91,055,046	N60S	probably benign	Het
Rapgef1	T	A	2: 29,726,214	D697E	probably damaging	Het
Rapgef3	T	A	15: 97,761,568	H54L	probably benign	Het
Rhobtb3	G	A	13: 75,872,453	R577*	probably null	Het
Safb2	T	C	17: 56,564,594	E218G	possibly damaging	Het
Scaf1	C	T	7: 45,008,426	R343H	probably damaging	Het
Snx24	G	A	18: 53,340,235		probably null	Het
Tbc1d1	T	C	5: 64,284,757	F707L	probably benign	Het
Tcaf2	T	C	6: 42,626,140	T829A	probably damaging	Het
Tcea2	C	T	2: 181,686,918	Q248*	probably null	Het
Tcirg1	A	T	19: 3,896,666	L729Q	probably damaging	Het
Thap3	A	G	4: 151,985,692	F82L	probably damaging	Het
Ttk	T	A	9: 83,868,092	M700K	probably damaging	Het
Ubap2l	G	T	3: 90,002,355	P56H	probably damaging	Het
Ubr2	A	G	17: 47,010,213	S3P	probably benign	Het
Uchl3	C	T	14: 101,685,692		probably benign	Het
Vmn2r111	T	A	17: 22,548,184	E777D	probably damaging	Het
Vmn2r20	A	T	6: 123,386,123	D567E	probably damaging	Het
Vps13c	T	G	9: 67,937,763	L2043R	probably damaging	Het
Zan	T	G	5: 137,400,134	D4212A	unknown	Het
Zap70	C	T	1: 36,778,751	P278S	probably benign	Het
Zbtb8b	A	T	4: 129,427,685	M461K	possibly damaging	Het
Zfat	T	G	15: 68,180,362	I528L	probably benign	Het
Zfp532	T	G	18: 65,638,763	V784G	probably benign	Het

Other mutations in 9530053A07Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:9530053A07Rik	APN	7	28164528	missense	probably damaging	1.00
IGL00757:9530053A07Rik	APN	7	28154445	missense	probably damaging	1.00
IGL01015:9530053A07Rik	APN	7	28155318	missense	probably damaging	1.00
IGL01079:9530053A07Rik	APN	7	28139778	missense	probably damaging	0.99
IGL01343:9530053A07Rik	APN	7	28150702	missense	probably benign	0.19
IGL01420:9530053A07Rik	APN	7	28140133	missense	probably benign	0.28
IGL01604:9530053A07Rik	APN	7	28155324	missense	probably benign	0.11
IGL01666:9530053A07Rik	APN	7	28153292	missense	probably damaging	1.00
IGL02002:9530053A07Rik	APN	7	28152796	missense	probably damaging	1.00
IGL02036:9530053A07Rik	APN	7	28137525	missense	possibly damaging	0.82
IGL02126:9530053A07Rik	APN	7	28139856	missense	probably damaging	1.00
IGL02150:9530053A07Rik	APN	7	28146779	nonsense	probably null
IGL02219:9530053A07Rik	APN	7	28154635	missense	probably damaging	1.00
IGL02563:9530053A07Rik	APN	7	28157892	missense	probably benign
IGL02804:9530053A07Rik	APN	7	28153370	missense	probably benign	0.00
IGL02830:9530053A07Rik	APN	7	28162923	missense	probably damaging	1.00
IGL02943:9530053A07Rik	APN	7	28147188	missense	probably damaging	1.00
IGL02977:9530053A07Rik	APN	7	28164372	missense	possibly damaging	0.83
IGL03231:9530053A07Rik	APN	7	28153722	missense	possibly damaging	0.95
IGL03304:9530053A07Rik	APN	7	28142242	missense	probably damaging	0.99
herz	UTSW	7	28153839	missense	possibly damaging	0.72
pulse	UTSW	7	28153749	missense	probably damaging	1.00
Sinusoidal	UTSW	7	28140130	missense	probably damaging	1.00
PIT4378001:9530053A07Rik	UTSW	7	28154464	missense	possibly damaging	0.61
R0023:9530053A07Rik	UTSW	7	28153412	missense	probably benign	0.00
R0131:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0131:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0132:9530053A07Rik	UTSW	7	28137615	missense	probably damaging	1.00
R0158:9530053A07Rik	UTSW	7	28155492	missense	probably damaging	1.00
R0230:9530053A07Rik	UTSW	7	28156825	missense	probably damaging	1.00
R0310:9530053A07Rik	UTSW	7	28142274	missense	probably benign	0.04
R0448:9530053A07Rik	UTSW	7	28140235	missense	probably benign	0.03
R0462:9530053A07Rik	UTSW	7	28137340	missense	probably damaging	1.00
R0481:9530053A07Rik	UTSW	7	28153749	missense	probably damaging	1.00
R0497:9530053A07Rik	UTSW	7	28147465	missense	probably damaging	1.00
R0556:9530053A07Rik	UTSW	7	28159378	missense	probably benign
R0562:9530053A07Rik	UTSW	7	28162690	missense	probably benign	0.30
R0586:9530053A07Rik	UTSW	7	28137091	missense	probably damaging	0.99
R0924:9530053A07Rik	UTSW	7	28140130	missense	probably damaging	1.00
R0930:9530053A07Rik	UTSW	7	28140130	missense	probably damaging	1.00
R1103:9530053A07Rik	UTSW	7	28154520	missense	probably damaging	1.00
R1213:9530053A07Rik	UTSW	7	28157673	missense	probably damaging	1.00
R1292:9530053A07Rik	UTSW	7	28142794	splice site	probably benign
R1368:9530053A07Rik	UTSW	7	28159478	missense	possibly damaging	0.89
R1451:9530053A07Rik	UTSW	7	28137157	missense	probably damaging	1.00
R1477:9530053A07Rik	UTSW	7	28157093	missense	probably benign	0.01
R1538:9530053A07Rik	UTSW	7	28155492	missense	probably damaging	1.00
R1655:9530053A07Rik	UTSW	7	28147110	missense	probably damaging	0.98
R1697:9530053A07Rik	UTSW	7	28154347	missense	probably damaging	1.00
R1741:9530053A07Rik	UTSW	7	28157854	missense	probably damaging	0.98
R1796:9530053A07Rik	UTSW	7	28155372	missense	probably damaging	1.00
R1853:9530053A07Rik	UTSW	7	28155546	nonsense	probably null
R1861:9530053A07Rik	UTSW	7	28154732	missense	probably damaging	1.00
R1909:9530053A07Rik	UTSW	7	28144348	missense	possibly damaging	0.52
R1971:9530053A07Rik	UTSW	7	28131512	missense	possibly damaging	0.90
R1990:9530053A07Rik	UTSW	7	28154360	missense	probably damaging	0.98
R2020:9530053A07Rik	UTSW	7	28155594	missense	probably benign
R2084:9530053A07Rik	UTSW	7	28157535	missense	probably damaging	1.00
R2125:9530053A07Rik	UTSW	7	28158022	missense	probably benign	0.00
R2132:9530053A07Rik	UTSW	7	28155474	missense	probably damaging	1.00
R2513:9530053A07Rik	UTSW	7	28131635	missense	probably damaging	0.99
R2913:9530053A07Rik	UTSW	7	28164307	missense	probably damaging	1.00
R3150:9530053A07Rik	UTSW	7	28154195	missense	probably benign	0.21
R3499:9530053A07Rik	UTSW	7	28154555	missense	probably benign	0.42
R3702:9530053A07Rik	UTSW	7	28157778	missense	probably damaging	1.00
R3881:9530053A07Rik	UTSW	7	28140038	nonsense	probably null
R3938:9530053A07Rik	UTSW	7	28154294	missense	probably damaging	1.00
R4050:9530053A07Rik	UTSW	7	28152985	missense	possibly damaging	0.55
R4152:9530053A07Rik	UTSW	7	28156897	missense	possibly damaging	0.47
R4168:9530053A07Rik	UTSW	7	28137109	missense	probably benign	0.05
R4235:9530053A07Rik	UTSW	7	28156648	missense	probably damaging	0.99
R4241:9530053A07Rik	UTSW	7	28154335	missense	probably damaging	1.00
R4363:9530053A07Rik	UTSW	7	28146906	missense	probably damaging	1.00
R4460:9530053A07Rik	UTSW	7	28152856	missense	probably benign	0.17
R4463:9530053A07Rik	UTSW	7	28150719	missense	probably benign
R4841:9530053A07Rik	UTSW	7	28150722	missense	probably damaging	1.00
R4842:9530053A07Rik	UTSW	7	28150722	missense	probably damaging	1.00
R4876:9530053A07Rik	UTSW	7	28142800	intron	probably benign
R4905:9530053A07Rik	UTSW	7	28156983	missense	possibly damaging	0.93
R4997:9530053A07Rik	UTSW	7	28143924	missense	possibly damaging	0.77
R5091:9530053A07Rik	UTSW	7	28156958	missense	probably benign	0.44
R5159:9530053A07Rik	UTSW	7	28153308	missense	probably benign	0.09
R5326:9530053A07Rik	UTSW	7	28155489	missense	probably damaging	0.98
R5396:9530053A07Rik	UTSW	7	28140183	missense	probably benign
R5441:9530053A07Rik	UTSW	7	28156914	missense	probably damaging	1.00
R5480:9530053A07Rik	UTSW	7	28157999	nonsense	probably null
R5542:9530053A07Rik	UTSW	7	28155489	missense	probably damaging	0.98
R5571:9530053A07Rik	UTSW	7	28156569	missense	probably damaging	0.99
R5613:9530053A07Rik	UTSW	7	28142878	intron	probably benign
R5637:9530053A07Rik	UTSW	7	28152852	missense	probably benign	0.00
R5766:9530053A07Rik	UTSW	7	28137329	nonsense	probably null
R6174:9530053A07Rik	UTSW	7	28139959	missense	probably damaging	0.96
R6233:9530053A07Rik	UTSW	7	28131460	missense	probably damaging	0.99
R6250:9530053A07Rik	UTSW	7	28150714	missense	probably damaging	1.00
R6379:9530053A07Rik	UTSW	7	28157592	missense	probably damaging	1.00
R6442:9530053A07Rik	UTSW	7	28144186	missense	possibly damaging	0.88
R6478:9530053A07Rik	UTSW	7	28155373	missense	probably damaging	1.00
R6699:9530053A07Rik	UTSW	7	28144368	missense	probably damaging	1.00
R6852:9530053A07Rik	UTSW	7	28147135	missense	probably damaging	1.00
R6883:9530053A07Rik	UTSW	7	28152835	missense	possibly damaging	0.89
R6902:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6903:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6904:9530053A07Rik	UTSW	7	28137213	missense	probably damaging	1.00
R6992:9530053A07Rik	UTSW	7	28140183	missense	probably benign	0.04
R7023:9530053A07Rik	UTSW	7	28140038	nonsense	probably null
R7171:9530053A07Rik	UTSW	7	28154519	nonsense	probably null
R7282:9530053A07Rik	UTSW	7	28144408	missense	probably benign	0.02
R7291:9530053A07Rik	UTSW	7	28140220	missense	probably benign
R7344:9530053A07Rik	UTSW	7	28140279	missense	possibly damaging	0.79
R7344:9530053A07Rik	UTSW	7	28152760	missense	possibly damaging	0.46
R7392:9530053A07Rik	UTSW	7	28164372	missense	possibly damaging	0.83
R7531:9530053A07Rik	UTSW	7	28140231	missense	probably benign
R7541:9530053A07Rik	UTSW	7	28144256	nonsense	probably null
R7577:9530053A07Rik	UTSW	7	28154423	missense	possibly damaging	0.65
R7594:9530053A07Rik	UTSW	7	28131460	missense	probably damaging	0.99
R7647:9530053A07Rik	UTSW	7	28140045	missense	probably benign	0.00
R7718:9530053A07Rik	UTSW	7	28147201	missense	probably damaging	1.00
R7733:9530053A07Rik	UTSW	7	28139965	missense	probably damaging	1.00
R7737:9530053A07Rik	UTSW	7	28157073	missense	probably damaging	1.00
R7908:9530053A07Rik	UTSW	7	28147496	missense	probably benign	0.12
R8013:9530053A07Rik	UTSW	7	28137541	missense	probably benign	0.14
R8014:9530053A07Rik	UTSW	7	28137541	missense	probably benign	0.14
R8151:9530053A07Rik	UTSW	7	28153341	missense	possibly damaging	0.95
R8175:9530053A07Rik	UTSW	7	28164448	nonsense	probably null
R8254:9530053A07Rik	UTSW	7	28147349	missense	possibly damaging	0.63
R8345:9530053A07Rik	UTSW	7	28155360	missense	probably damaging	1.00
R8414:9530053A07Rik	UTSW	7	28142733	missense	probably damaging	1.00
R8419:9530053A07Rik	UTSW	7	28143921	missense	probably damaging	1.00
R8496:9530053A07Rik	UTSW	7	28143952	missense	possibly damaging	0.81
R8691:9530053A07Rik	UTSW	7	28153839	missense	possibly damaging	0.72
R8785:9530053A07Rik	UTSW	7	28154707	missense	probably damaging	1.00
R8863:9530053A07Rik	UTSW	7	28131581	missense	probably damaging	1.00
R8926:9530053A07Rik	UTSW	7	28154444	missense	probably damaging	1.00
R8950:9530053A07Rik	UTSW	7	28164326	missense	probably benign	0.32
R9014:9530053A07Rik	UTSW	7	28155451	missense	probably damaging	1.00
R9045:9530053A07Rik	UTSW	7	28154431	missense	probably damaging	1.00
R9115:9530053A07Rik	UTSW	7	28154329	missense	possibly damaging	0.74
R9233:9530053A07Rik	UTSW	7	28140094	missense	possibly damaging	0.83
R9330:9530053A07Rik	UTSW	7	28156985	missense	probably benign	0.02
R9426:9530053A07Rik	UTSW	7	28143856	missense	possibly damaging	0.92
R9477:9530053A07Rik	UTSW	7	28152840	missense	probably damaging	1.00
R9502:9530053A07Rik	UTSW	7	28137466	missense	probably benign	0.09
R9505:9530053A07Rik	UTSW	7	28142484	nonsense	probably null
R9601:9530053A07Rik	UTSW	7	28154380	missense	possibly damaging	0.78
R9630:9530053A07Rik	UTSW	7	28137199	missense	probably damaging	1.00
R9632:9530053A07Rik	UTSW	7	28142301	missense	probably benign
R9673:9530053A07Rik	UTSW	7	28156619	missense	probably benign	0.25
R9735:9530053A07Rik	UTSW	7	28157010	missense	probably damaging	1.00
Z1176:9530053A07Rik	UTSW	7	28142386	missense	probably benign	0.06
Z1176:9530053A07Rik	UTSW	7	28154762	missense	probably benign	0.03
Z1177:9530053A07Rik	UTSW	7	28139898	missense	probably benign	0.25
Z1186:9530053A07Rik	UTSW	7	28131572	missense	probably benign
Z1186:9530053A07Rik	UTSW	7	28146705	missense	probably benign	0.00
Z1186:9530053A07Rik	UTSW	7	28156986	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCCCAGGTCAAGAAGTGTAC -3'
(R):5'- TCACCAGCACTTTGCCTTGG -3'

Sequencing Primer
(F):5'- TGTACGCGGACGAAAAATGCC -3'
(R):5'- TTGGTATTCCCGGCGCAC -3'

Posted On

2019-05-13