Incidental Mutation 'R7039:AI987944'
ID 546945
Institutional Source Beutler Lab
Gene Symbol AI987944
Ensembl Gene ENSMUSG00000056383
Gene Name expressed sequence AI987944
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R7039 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 41372923-41393379 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 41374456 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 366 (S366R)
Ref Sequence ENSEMBL: ENSMUSP00000145621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071804] [ENSMUST00000205338] [ENSMUST00000206801]
AlphaFold Q7TPX5
Predicted Effect probably benign
Transcript: ENSMUST00000071804
AA Change: S369R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071708
Gene: ENSMUSG00000056383
AA Change: S369R

DomainStartEndE-ValueType
KRAB 4 65 8.72e-15 SMART
ZnF_C2H2 74 96 1.24e2 SMART
ZnF_C2H2 130 152 2.43e-4 SMART
ZnF_C2H2 181 203 5.21e-4 SMART
ZnF_C2H2 209 231 3.95e-4 SMART
ZnF_C2H2 237 259 1.95e-3 SMART
ZnF_C2H2 265 287 4.87e-4 SMART
ZnF_C2H2 293 315 1.72e-4 SMART
ZnF_C2H2 321 343 8.47e-4 SMART
ZnF_C2H2 349 371 9.73e-4 SMART
ZnF_C2H2 377 399 3.69e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205338
AA Change: S366R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206801
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik G A 7: 28,140,148 R462Q possibly damaging Het
Actl7b A T 4: 56,741,022 L112Q probably damaging Het
Agap3 A C 5: 24,483,401 I396L probably benign Het
Aox3 A G 1: 58,176,555 T1049A probably damaging Het
Ap1g2 A T 14: 55,102,654 L407* probably null Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Brd3 T C 2: 27,456,917 K402E probably damaging Het
Cc2d2b A T 19: 40,802,401 D935V probably damaging Het
Cenpe A G 3: 135,255,456 N1904D probably benign Het
Cfap74 G T 4: 155,454,108 probably null Het
Chrdl2 A G 7: 100,028,672 T261A probably damaging Het
Cyp4a14 G A 4: 115,491,081 R400C probably benign Het
Dhfr G A 13: 92,355,283 V9I probably benign Het
Epha4 A G 1: 77,506,785 S196P probably damaging Het
Evc2 T A 5: 37,421,888 L1115Q probably damaging Het
Fat3 T A 9: 16,376,265 E654V probably damaging Het
Fer1l4 C T 2: 156,036,730 V14I probably benign Het
Frmd5 A T 2: 121,547,647 probably benign Het
Helz T C 11: 107,619,318 probably null Het
Igkv6-13 T C 6: 70,457,514 S116G probably benign Het
Iscu T C 5: 113,776,772 V115A possibly damaging Het
Jade2 C A 11: 51,828,359 K253N probably damaging Het
Katnal2 A G 18: 77,047,172 probably null Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Magi3 T C 3: 104,051,383 D462G probably damaging Het
Map3k14 T C 11: 103,221,035 N940S probably damaging Het
Masp2 A T 4: 148,602,586 M1L probably benign Het
Mga G A 2: 119,932,678 V1272I probably benign Het
Mib2 T C 4: 155,659,701 D168G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Msto1 A C 3: 88,911,390 V287G probably damaging Het
Myo5b T A 18: 74,701,528 D886E probably benign Het
Nek10 T C 14: 14,826,946 I48T possibly damaging Het
Nek10 A T 14: 14,986,700 R1013W probably damaging Het
Nipsnap3a T C 4: 53,000,130 V194A probably damaging Het
Nlrp9a A T 7: 26,567,942 T766S probably benign Het
Nol10 T A 12: 17,429,184 S672T possibly damaging Het
Olfr1062 A T 2: 86,422,833 I281K possibly damaging Het
Olfr1226 A T 2: 89,193,446 I196N probably damaging Het
Olfr1253 A T 2: 89,752,751 F26I probably benign Het
Olfr933 T A 9: 38,975,987 F104I probably damaging Het
Patj T A 4: 98,569,078 N1272K probably damaging Het
Peak1 T C 9: 56,257,809 E945G probably benign Het
Peg3 C T 7: 6,717,859 D16N probably damaging Het
Pik3r4 T G 9: 105,676,890 I1082M possibly damaging Het
Plekhg5 T A 4: 152,107,785 M472K possibly damaging Het
Plekhm1 T C 11: 103,395,228 D127G probably damaging Het
Ppfia4 G A 1: 134,312,115 S908L probably damaging Het
Psmc3 A G 2: 91,055,046 N60S probably benign Het
Rapgef1 T A 2: 29,726,214 D697E probably damaging Het
Rapgef3 T A 15: 97,761,568 H54L probably benign Het
Rhobtb3 G A 13: 75,872,453 R577* probably null Het
Safb2 T C 17: 56,564,594 E218G possibly damaging Het
Scaf1 C T 7: 45,008,426 R343H probably damaging Het
Snx24 G A 18: 53,340,235 probably null Het
Tbc1d1 T C 5: 64,284,757 F707L probably benign Het
Tcaf2 T C 6: 42,626,140 T829A probably damaging Het
Tcea2 C T 2: 181,686,918 Q248* probably null Het
Tcirg1 A T 19: 3,896,666 L729Q probably damaging Het
Thap3 A G 4: 151,985,692 F82L probably damaging Het
Ttk T A 9: 83,868,092 M700K probably damaging Het
Ubap2l G T 3: 90,002,355 P56H probably damaging Het
Ubr2 A G 17: 47,010,213 S3P probably benign Het
Uchl3 C T 14: 101,685,692 probably benign Het
Vmn2r111 T A 17: 22,548,184 E777D probably damaging Het
Vmn2r20 A T 6: 123,386,123 D567E probably damaging Het
Vps13c T G 9: 67,937,763 L2043R probably damaging Het
Zan T G 5: 137,400,134 D4212A unknown Het
Zap70 C T 1: 36,778,751 P278S probably benign Het
Zbtb8b A T 4: 129,427,685 M461K possibly damaging Het
Zfat T G 15: 68,180,362 I528L probably benign Het
Zfp532 T G 18: 65,638,763 V784G probably benign Het
Other mutations in AI987944
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03350:AI987944 APN 7 41393237 utr 5 prime probably benign
G1citation:AI987944 UTSW 7 41374808 missense probably damaging 1.00
R0744:AI987944 UTSW 7 41376859 missense probably damaging 1.00
R1083:AI987944 UTSW 7 41375339 missense probably benign 0.09
R1480:AI987944 UTSW 7 41374919 missense probably benign 0.00
R1485:AI987944 UTSW 7 41374530 nonsense probably null
R1491:AI987944 UTSW 7 41374348 nonsense probably null
R1662:AI987944 UTSW 7 41374449 missense possibly damaging 0.79
R1892:AI987944 UTSW 7 41374596 missense probably damaging 1.00
R1906:AI987944 UTSW 7 41375126 missense probably benign 0.02
R2037:AI987944 UTSW 7 41374391 missense probably benign 0.04
R2092:AI987944 UTSW 7 41374617 missense possibly damaging 0.58
R2202:AI987944 UTSW 7 41374526 missense probably damaging 0.98
R5070:AI987944 UTSW 7 41375324 missense probably benign 0.23
R5421:AI987944 UTSW 7 41374776 missense probably benign 0.02
R5531:AI987944 UTSW 7 41374390 nonsense probably null
R6822:AI987944 UTSW 7 41374808 missense probably damaging 1.00
R8133:AI987944 UTSW 7 41375065 critical splice donor site probably null
R8228:AI987944 UTSW 7 41376836 missense probably damaging 1.00
R8342:AI987944 UTSW 7 41374886 missense probably benign 0.01
R8826:AI987944 UTSW 7 41375203 missense possibly damaging 0.95
R9583:AI987944 UTSW 7 41374513 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGCACTCAAAATTACTGTGATGTG -3'
(R):5'- AAGCCTTTTCACAACAAGGTC -3'

Sequencing Primer
(F):5'- GGGTTCCTCTGCAATATAAATTGGC -3'
(R):5'- TTTTCACAACAAGGTCACCTCAG -3'
Posted On 2019-05-13