Incidental Mutation 'R7039:Myo5b'
ID 546975
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Name myosin VB
Synonyms
MMRRC Submission 045139-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.734) question?
Stock # R7039 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 74575435-74905769 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74834599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 886 (D886E)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000074157
AA Change: D886E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: D886E

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121875
AA Change: D886E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: D886E

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7b A T 4: 56,741,022 (GRCm39) L112Q probably damaging Het
Agap3 A C 5: 24,688,399 (GRCm39) I396L probably benign Het
AI987944 G T 7: 41,023,880 (GRCm39) S366R probably benign Het
Aox3 A G 1: 58,215,714 (GRCm39) T1049A probably damaging Het
Ap1g2 A T 14: 55,340,111 (GRCm39) L407* probably null Het
Baiap3 G A 17: 25,462,814 (GRCm39) R1075C probably benign Het
Brd3 T C 2: 27,346,929 (GRCm39) K402E probably damaging Het
Cc2d2b A T 19: 40,790,845 (GRCm39) D935V probably damaging Het
Cenpe A G 3: 134,961,217 (GRCm39) N1904D probably benign Het
Cfap74 G T 4: 155,538,565 (GRCm39) probably null Het
Chrdl2 A G 7: 99,677,879 (GRCm39) T261A probably damaging Het
Cyp4a14 G A 4: 115,348,278 (GRCm39) R400C probably benign Het
Dhfr G A 13: 92,491,791 (GRCm39) V9I probably benign Het
Epha4 A G 1: 77,483,422 (GRCm39) S196P probably damaging Het
Evc2 T A 5: 37,579,232 (GRCm39) L1115Q probably damaging Het
Fat3 T A 9: 16,287,561 (GRCm39) E654V probably damaging Het
Fcgbpl1 G A 7: 27,839,573 (GRCm39) R462Q possibly damaging Het
Fer1l4 C T 2: 155,878,650 (GRCm39) V14I probably benign Het
Frmd5 A T 2: 121,378,128 (GRCm39) probably benign Het
Helz T C 11: 107,510,144 (GRCm39) probably null Het
Igkv6-13 T C 6: 70,434,498 (GRCm39) S116G probably benign Het
Iscu T C 5: 113,914,833 (GRCm39) V115A possibly damaging Het
Jade2 C A 11: 51,719,186 (GRCm39) K253N probably damaging Het
Katnal2 A G 18: 77,134,868 (GRCm39) probably null Het
Kif13a C T 13: 46,905,931 (GRCm39) V671M possibly damaging Het
Magi3 T C 3: 103,958,699 (GRCm39) D462G probably damaging Het
Map3k14 T C 11: 103,111,861 (GRCm39) N940S probably damaging Het
Masp2 A T 4: 148,687,043 (GRCm39) M1L probably benign Het
Mga G A 2: 119,763,159 (GRCm39) V1272I probably benign Het
Mib2 T C 4: 155,744,158 (GRCm39) D168G probably damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Msto1 A C 3: 88,818,697 (GRCm39) V287G probably damaging Het
Nek10 T C 14: 14,826,946 (GRCm38) I48T possibly damaging Het
Nek10 A T 14: 14,986,700 (GRCm38) R1013W probably damaging Het
Nipsnap3a T C 4: 53,000,130 (GRCm39) V194A probably damaging Het
Nlrp9a A T 7: 26,267,367 (GRCm39) T766S probably benign Het
Nol10 T A 12: 17,479,185 (GRCm39) S672T possibly damaging Het
Or4a80 A T 2: 89,583,095 (GRCm39) F26I probably benign Het
Or4c121 A T 2: 89,023,790 (GRCm39) I196N probably damaging Het
Or8d1b T A 9: 38,887,283 (GRCm39) F104I probably damaging Het
Or8j3c A T 2: 86,253,177 (GRCm39) I281K possibly damaging Het
Patj T A 4: 98,457,315 (GRCm39) N1272K probably damaging Het
Peak1 T C 9: 56,165,093 (GRCm39) E945G probably benign Het
Peg3 C T 7: 6,720,858 (GRCm39) D16N probably damaging Het
Pik3r4 T G 9: 105,554,089 (GRCm39) I1082M possibly damaging Het
Plekhg5 T A 4: 152,192,242 (GRCm39) M472K possibly damaging Het
Plekhm1 T C 11: 103,286,054 (GRCm39) D127G probably damaging Het
Ppfia4 G A 1: 134,239,853 (GRCm39) S908L probably damaging Het
Psmc3 A G 2: 90,885,391 (GRCm39) N60S probably benign Het
Rapgef1 T A 2: 29,616,226 (GRCm39) D697E probably damaging Het
Rapgef3 T A 15: 97,659,449 (GRCm39) H54L probably benign Het
Rhobtb3 G A 13: 76,020,572 (GRCm39) R577* probably null Het
Safb2 T C 17: 56,871,594 (GRCm39) E218G possibly damaging Het
Scaf1 C T 7: 44,657,850 (GRCm39) R343H probably damaging Het
Snx24 G A 18: 53,473,307 (GRCm39) probably null Het
Tbc1d1 T C 5: 64,442,100 (GRCm39) F707L probably benign Het
Tcaf2 T C 6: 42,603,074 (GRCm39) T829A probably damaging Het
Tcea2 C T 2: 181,328,711 (GRCm39) Q248* probably null Het
Tcirg1 A T 19: 3,946,666 (GRCm39) L729Q probably damaging Het
Thap3 A G 4: 152,070,149 (GRCm39) F82L probably damaging Het
Ttk T A 9: 83,750,145 (GRCm39) M700K probably damaging Het
Ubap2l G T 3: 89,909,662 (GRCm39) P56H probably damaging Het
Ubr2 A G 17: 47,321,139 (GRCm39) S3P probably benign Het
Uchl3 C T 14: 101,923,128 (GRCm39) probably benign Het
Vmn2r111 T A 17: 22,767,165 (GRCm39) E777D probably damaging Het
Vmn2r20 A T 6: 123,363,082 (GRCm39) D567E probably damaging Het
Vps13c T G 9: 67,845,045 (GRCm39) L2043R probably damaging Het
Zan T G 5: 137,398,396 (GRCm39) D4212A unknown Het
Zap70 C T 1: 36,817,832 (GRCm39) P278S probably benign Het
Zbtb8b A T 4: 129,321,478 (GRCm39) M461K possibly damaging Het
Zfat T G 15: 68,052,211 (GRCm39) I528L probably benign Het
Zfp532 T G 18: 65,771,834 (GRCm39) V784G probably benign Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74,787,147 (GRCm39) splice site probably benign
IGL01083:Myo5b APN 18 74,866,974 (GRCm39) splice site probably benign
IGL01448:Myo5b APN 18 74,777,161 (GRCm39) missense probably damaging 0.97
IGL01516:Myo5b APN 18 74,760,266 (GRCm39) missense probably damaging 0.99
IGL01525:Myo5b APN 18 74,873,620 (GRCm39) missense probably damaging 1.00
IGL01873:Myo5b APN 18 74,713,467 (GRCm39) missense probably damaging 1.00
IGL01887:Myo5b APN 18 74,848,007 (GRCm39) missense probably benign 0.41
IGL01953:Myo5b APN 18 74,702,838 (GRCm39) missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74,831,348 (GRCm39) missense probably damaging 1.00
IGL02017:Myo5b APN 18 74,850,070 (GRCm39) missense probably damaging 1.00
IGL02331:Myo5b APN 18 74,771,111 (GRCm39) critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74,848,010 (GRCm39) missense probably damaging 0.98
IGL02707:Myo5b APN 18 74,828,438 (GRCm39) splice site probably benign
IGL02806:Myo5b APN 18 74,750,151 (GRCm39) critical splice donor site probably null
IGL03009:Myo5b APN 18 74,894,039 (GRCm39) missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74,713,615 (GRCm39) splice site probably benign
IGL03061:Myo5b APN 18 74,767,630 (GRCm39) missense probably benign 0.02
unrat UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
BB017:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R0085:Myo5b UTSW 18 74,834,751 (GRCm39) missense probably benign 0.21
R0114:Myo5b UTSW 18 74,875,242 (GRCm39) missense probably benign 0.03
R0226:Myo5b UTSW 18 74,875,251 (GRCm39) missense probably benign
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74,862,025 (GRCm39) splice site probably benign
R0494:Myo5b UTSW 18 74,787,038 (GRCm39) missense probably damaging 1.00
R0920:Myo5b UTSW 18 74,758,712 (GRCm39) missense probably benign 0.09
R1144:Myo5b UTSW 18 74,758,658 (GRCm39) missense probably damaging 1.00
R1177:Myo5b UTSW 18 74,777,143 (GRCm39) missense probably damaging 1.00
R1387:Myo5b UTSW 18 74,777,272 (GRCm39) splice site probably benign
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1555:Myo5b UTSW 18 74,702,853 (GRCm39) missense probably damaging 1.00
R1587:Myo5b UTSW 18 74,867,061 (GRCm39) missense probably benign
R1600:Myo5b UTSW 18 74,846,611 (GRCm39) unclassified probably benign
R1639:Myo5b UTSW 18 74,840,987 (GRCm39) missense probably benign 0.19
R1779:Myo5b UTSW 18 74,875,218 (GRCm39) missense probably benign 0.06
R1806:Myo5b UTSW 18 74,710,680 (GRCm39) missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2046:Myo5b UTSW 18 74,710,526 (GRCm39) missense probably benign 0.28
R2093:Myo5b UTSW 18 74,892,263 (GRCm39) missense probably damaging 0.98
R2270:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2272:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2298:Myo5b UTSW 18 74,758,676 (GRCm39) missense probably damaging 1.00
R2433:Myo5b UTSW 18 74,892,158 (GRCm39) missense probably damaging 1.00
R2888:Myo5b UTSW 18 74,895,689 (GRCm39) missense probably damaging 1.00
R3824:Myo5b UTSW 18 74,794,726 (GRCm39) missense probably benign 0.41
R3937:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3938:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3947:Myo5b UTSW 18 74,828,474 (GRCm39) missense probably damaging 1.00
R3971:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3972:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3974:Myo5b UTSW 18 74,767,552 (GRCm39) missense probably damaging 1.00
R4027:Myo5b UTSW 18 74,892,311 (GRCm39) missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74,873,559 (GRCm39) missense probably benign
R4285:Myo5b UTSW 18 74,847,920 (GRCm39) missense probably benign
R4308:Myo5b UTSW 18 74,864,811 (GRCm39) missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74,831,345 (GRCm39) missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74,713,479 (GRCm39) missense probably damaging 1.00
R4516:Myo5b UTSW 18 74,758,745 (GRCm39) missense probably damaging 1.00
R4690:Myo5b UTSW 18 74,855,533 (GRCm39) missense probably damaging 0.97
R4781:Myo5b UTSW 18 74,877,752 (GRCm39) missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74,828,451 (GRCm39) missense probably benign 0.01
R4796:Myo5b UTSW 18 74,877,701 (GRCm39) missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74,828,455 (GRCm39) missense probably benign 0.19
R4972:Myo5b UTSW 18 74,760,264 (GRCm39) missense probably damaging 0.98
R5004:Myo5b UTSW 18 74,877,844 (GRCm39) critical splice donor site probably null
R5024:Myo5b UTSW 18 74,849,105 (GRCm39) missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74,771,224 (GRCm39) critical splice donor site probably null
R5187:Myo5b UTSW 18 74,834,745 (GRCm39) missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74,848,003 (GRCm39) missense probably damaging 0.99
R5254:Myo5b UTSW 18 74,833,677 (GRCm39) missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74,795,741 (GRCm39) missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74,875,246 (GRCm39) missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74,787,128 (GRCm39) missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74,834,592 (GRCm39) missense probably benign
R5875:Myo5b UTSW 18 74,840,973 (GRCm39) splice site probably null
R6088:Myo5b UTSW 18 74,853,969 (GRCm39) missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74,833,750 (GRCm39) missense probably benign 0.19
R6237:Myo5b UTSW 18 74,875,249 (GRCm39) missense probably damaging 1.00
R6265:Myo5b UTSW 18 74,710,511 (GRCm39) splice site probably null
R6267:Myo5b UTSW 18 74,750,062 (GRCm39) missense probably damaging 1.00
R6328:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6330:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6331:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6347:Myo5b UTSW 18 74,903,456 (GRCm39) missense probably benign 0.11
R6479:Myo5b UTSW 18 74,750,086 (GRCm39) missense probably damaging 1.00
R6748:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74,750,106 (GRCm39) missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74,903,396 (GRCm39) missense probably benign
R6876:Myo5b UTSW 18 74,841,026 (GRCm39) missense probably benign
R6880:Myo5b UTSW 18 74,855,501 (GRCm39) missense probably benign 0.02
R6902:Myo5b UTSW 18 74,809,756 (GRCm39) missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
R7162:Myo5b UTSW 18 74,828,498 (GRCm39) missense probably benign 0.02
R7345:Myo5b UTSW 18 74,841,095 (GRCm39) missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74,864,802 (GRCm39) missense probably benign 0.00
R7564:Myo5b UTSW 18 74,767,582 (GRCm39) missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74,760,325 (GRCm39) critical splice donor site probably null
R7635:Myo5b UTSW 18 74,713,467 (GRCm39) missense probably damaging 1.00
R7670:Myo5b UTSW 18 74,834,517 (GRCm39) missense probably benign 0.05
R7754:Myo5b UTSW 18 74,767,630 (GRCm39) missense probably benign 0.02
R7930:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R8013:Myo5b UTSW 18 74,893,970 (GRCm39) nonsense probably null
R8271:Myo5b UTSW 18 74,760,261 (GRCm39) missense probably damaging 1.00
R8312:Myo5b UTSW 18 74,867,033 (GRCm39) missense probably damaging 1.00
R8383:Myo5b UTSW 18 74,777,049 (GRCm39) missense probably benign 0.05
R8384:Myo5b UTSW 18 74,875,273 (GRCm39) missense probably damaging 1.00
R8474:Myo5b UTSW 18 74,903,411 (GRCm39) missense probably damaging 1.00
R8825:Myo5b UTSW 18 74,892,169 (GRCm39) missense possibly damaging 0.79
R8846:Myo5b UTSW 18 74,841,043 (GRCm39) missense probably benign 0.04
R9236:Myo5b UTSW 18 74,853,934 (GRCm39) missense probably benign
R9283:Myo5b UTSW 18 74,777,149 (GRCm39) missense probably benign 0.16
R9370:Myo5b UTSW 18 74,760,246 (GRCm39) missense possibly damaging 0.54
R9506:Myo5b UTSW 18 74,877,831 (GRCm39) missense possibly damaging 0.82
R9523:Myo5b UTSW 18 74,861,968 (GRCm39) missense possibly damaging 0.89
R9622:Myo5b UTSW 18 74,848,017 (GRCm39) missense probably damaging 0.99
R9676:Myo5b UTSW 18 74,892,231 (GRCm39) missense probably benign 0.22
R9725:Myo5b UTSW 18 74,856,841 (GRCm39) missense probably benign
RF009:Myo5b UTSW 18 74,777,070 (GRCm39) missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74,877,820 (GRCm39) missense probably benign 0.35
Z1177:Myo5b UTSW 18 74,750,088 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TACAGGCCACATATGCATGG -3'
(R):5'- ACACCCATGTAGGAGACTCC -3'

Sequencing Primer
(F):5'- AGGCCACATATGCATGGTCTCC -3'
(R):5'- GGAGACTCCTACCACTGACCTG -3'
Posted On 2019-05-13