Incidental Mutation 'R7040:Bmp2'
ID 546981
Institutional Source Beutler Lab
Gene Symbol Bmp2
Ensembl Gene ENSMUSG00000027358
Gene Name bone morphogenetic protein 2
Synonyms Bmp2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 133552159-133562885 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 133561684 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 385 (D385G)
Ref Sequence ENSEMBL: ENSMUSP00000028836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028836]
AlphaFold P21274
Predicted Effect probably damaging
Transcript: ENSMUST00000028836
AA Change: D385G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028836
Gene: ENSMUSG00000027358
AA Change: D385G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:TGFb_propeptide 35 265 7.9e-55 PFAM
TGFB 294 394 9.33e-69 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer, which plays a role in bone and cartilage development. While a homozygous knockout mouse for this gene exhibits embryonic lethality, conditional knockout mice have defects in bone, cartilage and heart development. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mutants die at embryonic day 7.5-9 with failure of the proamniotic canal to close and abnormal development of the heart in the exocoelomic cavity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Bmp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bmp2 APN 2 133561027 missense probably benign
IGL01146:Bmp2 APN 2 133561300 missense probably benign 0.12
IGL01933:Bmp2 APN 2 133554658 missense possibly damaging 0.90
IGL02008:Bmp2 APN 2 133560966 missense probably damaging 0.99
IGL02047:Bmp2 APN 2 133560976 missense probably damaging 1.00
IGL02065:Bmp2 APN 2 133560924 missense probably benign 0.17
IGL02703:Bmp2 APN 2 133561404 missense probably benign
R1136:Bmp2 UTSW 2 133560927 missense probably damaging 1.00
R1184:Bmp2 UTSW 2 133561468 missense probably damaging 1.00
R2032:Bmp2 UTSW 2 133561296 missense probably benign 0.00
R3683:Bmp2 UTSW 2 133554472 missense probably benign 0.03
R4468:Bmp2 UTSW 2 133554454 missense probably benign
R5211:Bmp2 UTSW 2 133554630 missense probably damaging 0.99
R5324:Bmp2 UTSW 2 133561359 nonsense probably null
R5587:Bmp2 UTSW 2 133554646 missense possibly damaging 0.94
R7574:Bmp2 UTSW 2 133560897 missense probably benign
R7965:Bmp2 UTSW 2 133561185 missense probably benign 0.01
R8537:Bmp2 UTSW 2 133561282 missense probably damaging 0.99
R8805:Bmp2 UTSW 2 133561334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGGGAGTGTCCTTTTCC -3'
(R):5'- ATGTGCTGGAGTTGAACCC -3'

Sequencing Primer
(F):5'- CCCTTGCTGACCACCTGAAC -3'
(R):5'- GCTGGAGTTGAACCCATATAAAATG -3'
Posted On 2019-05-13