Mutagenetix > Incidental Mutation

Incidental Mutation 'R7040:Plcb4'

546982

Institutional Source

Beutler Lab

Gene Symbol

Plcb4

Ensembl Gene

ENSMUSG00000039943

Gene Name

phospholipase C, beta 4

Synonyms

A930039J07Rik, C230058B11Rik

MMRRC Submission

045013-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7040 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

135659011-136014593 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 135932262 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 155 (A155T)

Ref Sequence

ENSEMBL: ENSMUSP00000139274 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035646] [ENSMUST00000110109] [ENSMUST00000134310] [ENSMUST00000184371]

AlphaFold

Q91UZ1

Predicted Effect

probably benign
Transcript: ENSMUST00000035646
AA Change: A155T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000038409
Gene: ENSMUSG00000039943
AA Change: A155T

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	221	312	1.1e-26	PFAM
PLCXc	313	463	2.68e-79	SMART
low complexity region	498	509	N/A	INTRINSIC
PLCYc	565	681	2.9e-75	SMART
C2	702	801	1.6e-14	SMART
Pfam:DUF1154	909	955	4.3e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110109
AA Change: A155T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105736
Gene: ENSMUSG00000039943
AA Change: A155T

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	221	312	6.1e-27	PFAM
PLCXc	313	463	2.68e-79	SMART
low complexity region	498	509	N/A	INTRINSIC
PLCYc	565	681	2.9e-75	SMART
C2	702	801	1.6e-14	SMART
Pfam:DUF1154	913	955	1.2e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134310
AA Change: A155T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000117638
Gene: ENSMUSG00000039943
AA Change: A155T

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	221	312	2.5e-27	PFAM
PLCXc	313	463	2.68e-79	SMART
low complexity region	498	509	N/A	INTRINSIC
PLCYc	577	693	2.9e-75	SMART
C2	714	813	1.6e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184371
AA Change: A155T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000139274
Gene: ENSMUSG00000039943
AA Change: A155T

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	221	312	9e-27	PFAM
PLCXc	313	463	2.68e-79	SMART
low complexity region	498	509	N/A	INTRINSIC
PLCYc	565	681	2.9e-75	SMART
C2	702	801	1.6e-14	SMART
Pfam:DUF1154	909	955	4.1e-23	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals in the retina. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for targeted mutations may exhibit ataxia, impaired elimination of excess climbing fiber synapses in the developing cerebellum, abnormal cerebellar foliation, reduced visual processing ability and loss of circadian rhythm in constant darkness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130023H24Rik	A	G	7: 128,236,725	L232P	possibly damaging	Het
Acaa1a	T	C	9: 119,349,038	V312A	probably damaging	Het
Bmp2	A	G	2: 133,561,684	D385G	probably damaging	Het
C1qtnf9	T	C	14: 60,779,792	V257A	probably damaging	Het
Cd3d	G	A	9: 44,985,693	V122I	probably damaging	Het
Cdc37	T	C	9: 21,142,223	E199G	probably damaging	Het
Crb2	T	A	2: 37,787,684	D326E	probably benign	Het
Cyp2c29	A	C	19: 39,330,337	K420N	possibly damaging	Het
Cyp2g1	A	C	7: 26,820,759	D472A	probably damaging	Het
Dab2	A	C	15: 6,422,251	H116P	probably damaging	Het
Dnah7b	G	C	1: 46,236,809	E2619Q	probably benign	Het
Dsg4	A	T	18: 20,451,852	M208L	probably benign	Het
Eif4enif1	T	G	11: 3,234,040	V521G	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fpr-rs6	A	G	17: 20,182,934	M55T	probably damaging	Het
Grhpr	A	G	4: 44,985,362	S101G	probably damaging	Het
Kif15	T	A	9: 123,011,614	D33E	possibly damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lama4	A	G	10: 39,060,162	Q611R	possibly damaging	Het
Lrrc47	T	A	4: 154,020,452	*123R	probably null	Het
Map4k3	A	C	17: 80,680,915	V36G	probably damaging	Het
Mme	T	A	3: 63,368,923	I707N	probably damaging	Het
Muc2	A	G	7: 141,751,457	E166G	unknown	Het
Mucl1	T	A	15: 103,753,578	T108S	possibly damaging	Het
Myo1h	A	T	5: 114,359,744	D53V	possibly damaging	Het
Naa15	T	A	3: 51,472,784	L811Q	possibly damaging	Het
Nalcn	T	C	14: 123,287,855	T1487A	probably benign	Het
Nme8	A	T	13: 19,694,328	L87H	probably damaging	Het
Nr2e1	A	G	10: 42,568,378	V245A	probably damaging	Het
Nt5c2	A	T	19: 46,893,535	F291Y	possibly damaging	Het
Olfr1337	T	C	4: 118,781,986	M200V	probably benign	Het
Olfr1508	T	C	14: 52,463,475	D178G	possibly damaging	Het
Olfr556	A	T	7: 102,670,730	Q270L	probably benign	Het
Olfr668	A	T	7: 104,925,510	C85S	probably benign	Het
Ooep	T	C	9: 78,378,401	N43S	possibly damaging	Het
Ovch2	A	T	7: 107,796,565	I82N	probably damaging	Het
Palb2	A	T	7: 122,114,399	M524K	possibly damaging	Het
Patj	T	C	4: 98,441,080	S524P	probably benign	Het
Patl1	T	A	19: 11,929,954	Y401N	possibly damaging	Het
Pcdhb20	A	T	18: 37,504,717	T99S	probably benign	Het
Rpap3	A	G	15: 97,679,112	V585A	possibly damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spen	T	A	4: 141,494,382	T302S	unknown	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Ube2o	T	C	11: 116,541,860	E760G	probably benign	Het
Uimc1	T	A	13: 55,075,454		probably null	Het
Usp16	C	T	16: 87,480,929	A689V	probably damaging	Het
Vmn2r60	G	A	7: 42,142,242	A530T	probably benign	Het
Vps8	T	A	16: 21,575,022	M1185K	probably damaging	Het
Vwa8	T	C	14: 78,912,205	S136P	probably damaging	Het
Ythdc2	A	G	18: 44,834,462	N175S	probably benign	Het
Zfp160	A	T	17: 21,026,532	H448L	probably damaging	Het
Zfp90	T	A	8: 106,425,009	C451*	probably null	Het
Zfp945	A	G	17: 22,852,290	C212R	probably damaging	Het

Other mutations in Plcb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Plcb4	APN	2	135971798	missense	probably benign	0.26
IGL01405:Plcb4	APN	2	135950347	missense	probably damaging	1.00
IGL01522:Plcb4	APN	2	136002627	missense	probably damaging	1.00
IGL01589:Plcb4	APN	2	135967118	missense	probably benign
IGL02090:Plcb4	APN	2	135947121	missense	probably benign	0.00
IGL02247:Plcb4	APN	2	135994325	missense	possibly damaging	0.95
IGL02259:Plcb4	APN	2	135910246	critical splice donor site	probably null
IGL02338:Plcb4	APN	2	136000180	missense	possibly damaging	0.87
IGL02625:Plcb4	APN	2	135961794	missense	probably benign	0.19
IGL03026:Plcb4	APN	2	135950429	splice site	probably benign
IGL03111:Plcb4	APN	2	135976282	missense	probably damaging	1.00
R0044:Plcb4	UTSW	2	135971856	missense	probably damaging	1.00
R0066:Plcb4	UTSW	2	135961769	missense	probably benign	0.10
R0066:Plcb4	UTSW	2	135961769	missense	probably benign	0.10
R0143:Plcb4	UTSW	2	135976211	missense	probably damaging	1.00
R0234:Plcb4	UTSW	2	135982075	missense	probably benign	0.00
R0234:Plcb4	UTSW	2	135982075	missense	probably benign	0.00
R0348:Plcb4	UTSW	2	135968419	missense	probably damaging	1.00
R0557:Plcb4	UTSW	2	135954349	missense	probably damaging	0.99
R0591:Plcb4	UTSW	2	135955012	splice site	probably benign
R0975:Plcb4	UTSW	2	135987912	splice site	probably benign
R1187:Plcb4	UTSW	2	135968394	missense	probably benign	0.36
R1235:Plcb4	UTSW	2	135972948	missense	probably damaging	1.00
R1445:Plcb4	UTSW	2	136000189	missense	possibly damaging	0.90
R1562:Plcb4	UTSW	2	135970447	critical splice donor site	probably null
R1594:Plcb4	UTSW	2	135970390	splice site	probably benign
R1920:Plcb4	UTSW	2	136013027	missense	probably damaging	1.00
R2041:Plcb4	UTSW	2	135938271	missense	probably damaging	1.00
R2141:Plcb4	UTSW	2	135976099	missense	probably damaging	1.00
R2142:Plcb4	UTSW	2	135976099	missense	probably damaging	1.00
R2202:Plcb4	UTSW	2	136002594	missense	probably benign	0.01
R2203:Plcb4	UTSW	2	136002594	missense	probably benign	0.01
R2204:Plcb4	UTSW	2	136002594	missense	probably benign	0.01
R2250:Plcb4	UTSW	2	135971861	critical splice donor site	probably null
R2291:Plcb4	UTSW	2	135939983	missense	probably benign	0.08
R2326:Plcb4	UTSW	2	135939973	missense	probably damaging	0.99
R2442:Plcb4	UTSW	2	135950382	missense	probably damaging	1.00
R2939:Plcb4	UTSW	2	135939203	splice site	probably benign
R3774:Plcb4	UTSW	2	135958145	missense	probably benign	0.00
R3875:Plcb4	UTSW	2	136002632	missense	probably damaging	0.99
R4594:Plcb4	UTSW	2	136002599	missense	probably damaging	0.98
R4673:Plcb4	UTSW	2	135932271	missense	possibly damaging	0.68
R4812:Plcb4	UTSW	2	136007881	missense	probably damaging	1.00
R5084:Plcb4	UTSW	2	136002651	missense	probably damaging	1.00
R5468:Plcb4	UTSW	2	135967152	missense	probably damaging	1.00
R5498:Plcb4	UTSW	2	135976172	missense	probably damaging	1.00
R5923:Plcb4	UTSW	2	135961814	nonsense	probably null
R6241:Plcb4	UTSW	2	135910174	missense	possibly damaging	0.80
R6492:Plcb4	UTSW	2	135973071	nonsense	probably null
R6514:Plcb4	UTSW	2	135954996	missense	probably benign	0.22
R6570:Plcb4	UTSW	2	135982986	missense	probably benign	0.13
R6721:Plcb4	UTSW	2	135910237	missense	probably benign	0.01
R6915:Plcb4	UTSW	2	135947115	missense	possibly damaging	0.84
R6991:Plcb4	UTSW	2	135910194	missense	probably damaging	1.00
R7086:Plcb4	UTSW	2	136007847	missense	probably benign
R7114:Plcb4	UTSW	2	135982123	critical splice donor site	probably null
R7249:Plcb4	UTSW	2	136007821	critical splice acceptor site	probably null
R7264:Plcb4	UTSW	2	135965080	missense	probably benign
R7361:Plcb4	UTSW	2	135976148	missense	possibly damaging	0.82
R7426:Plcb4	UTSW	2	136000219	missense	probably benign	0.00
R7429:Plcb4	UTSW	2	135968322	missense	probably damaging	1.00
R7430:Plcb4	UTSW	2	135968322	missense	probably damaging	1.00
R8010:Plcb4	UTSW	2	135907560	missense	probably benign	0.00
R8141:Plcb4	UTSW	2	135939249	missense	probably damaging	1.00
R9072:Plcb4	UTSW	2	136007875	missense	possibly damaging	0.93
R9119:Plcb4	UTSW	2	135967952	missense	probably damaging	1.00
R9287:Plcb4	UTSW	2	135987897	missense	probably benign	0.00
R9448:Plcb4	UTSW	2	135910125	missense	possibly damaging	0.47
R9578:Plcb4	UTSW	2	135987524	missense	probably benign	0.00
Z1177:Plcb4	UTSW	2	135958738	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCATGTTTTGCTCAGTGC -3'
(R):5'- ATTATGTCATAGCCGGGTGG -3'

Sequencing Primer
(F):5'- CATAGGCCTCTCGGTTAAATTTG -3'
(R):5'- CCGGGTGGGCCTTTGAC -3'

Posted On

2019-05-13