Incidental Mutation 'R7040:Plcb4'
ID 546982
Institutional Source Beutler Lab
Gene Symbol Plcb4
Ensembl Gene ENSMUSG00000039943
Gene Name phospholipase C, beta 4
Synonyms A930039J07Rik, C230058B11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 135659011-136014593 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 135932262 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 155 (A155T)
Ref Sequence ENSEMBL: ENSMUSP00000139274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035646] [ENSMUST00000110109] [ENSMUST00000134310] [ENSMUST00000184371]
AlphaFold Q91UZ1
Predicted Effect probably benign
Transcript: ENSMUST00000035646
AA Change: A155T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038409
Gene: ENSMUSG00000039943
AA Change: A155T

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 1.1e-26 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 909 955 4.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110109
AA Change: A155T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105736
Gene: ENSMUSG00000039943
AA Change: A155T

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 6.1e-27 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 913 955 1.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134310
AA Change: A155T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117638
Gene: ENSMUSG00000039943
AA Change: A155T

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 2.5e-27 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 577 693 2.9e-75 SMART
C2 714 813 1.6e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184371
AA Change: A155T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139274
Gene: ENSMUSG00000039943
AA Change: A155T

DomainStartEndE-ValueType
Pfam:EF-hand_like 221 312 9e-27 PFAM
PLCXc 313 463 2.68e-79 SMART
low complexity region 498 509 N/A INTRINSIC
PLCYc 565 681 2.9e-75 SMART
C2 702 801 1.6e-14 SMART
Pfam:DUF1154 909 955 4.1e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals in the retina. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for targeted mutations may exhibit ataxia, impaired elimination of excess climbing fiber synapses in the developing cerebellum, abnormal cerebellar foliation, reduced visual processing ability and loss of circadian rhythm in constant darkness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Plcb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Plcb4 APN 2 135971798 missense probably benign 0.26
IGL01405:Plcb4 APN 2 135950347 missense probably damaging 1.00
IGL01522:Plcb4 APN 2 136002627 missense probably damaging 1.00
IGL01589:Plcb4 APN 2 135967118 missense probably benign
IGL02090:Plcb4 APN 2 135947121 missense probably benign 0.00
IGL02247:Plcb4 APN 2 135994325 missense possibly damaging 0.95
IGL02259:Plcb4 APN 2 135910246 critical splice donor site probably null
IGL02338:Plcb4 APN 2 136000180 missense possibly damaging 0.87
IGL02625:Plcb4 APN 2 135961794 missense probably benign 0.19
IGL03026:Plcb4 APN 2 135950429 splice site probably benign
IGL03111:Plcb4 APN 2 135976282 missense probably damaging 1.00
R0044:Plcb4 UTSW 2 135971856 missense probably damaging 1.00
R0066:Plcb4 UTSW 2 135961769 missense probably benign 0.10
R0066:Plcb4 UTSW 2 135961769 missense probably benign 0.10
R0143:Plcb4 UTSW 2 135976211 missense probably damaging 1.00
R0234:Plcb4 UTSW 2 135982075 missense probably benign 0.00
R0234:Plcb4 UTSW 2 135982075 missense probably benign 0.00
R0348:Plcb4 UTSW 2 135968419 missense probably damaging 1.00
R0557:Plcb4 UTSW 2 135954349 missense probably damaging 0.99
R0591:Plcb4 UTSW 2 135955012 splice site probably benign
R0975:Plcb4 UTSW 2 135987912 splice site probably benign
R1187:Plcb4 UTSW 2 135968394 missense probably benign 0.36
R1235:Plcb4 UTSW 2 135972948 missense probably damaging 1.00
R1445:Plcb4 UTSW 2 136000189 missense possibly damaging 0.90
R1562:Plcb4 UTSW 2 135970447 critical splice donor site probably null
R1594:Plcb4 UTSW 2 135970390 splice site probably benign
R1920:Plcb4 UTSW 2 136013027 missense probably damaging 1.00
R2041:Plcb4 UTSW 2 135938271 missense probably damaging 1.00
R2141:Plcb4 UTSW 2 135976099 missense probably damaging 1.00
R2142:Plcb4 UTSW 2 135976099 missense probably damaging 1.00
R2202:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2203:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2204:Plcb4 UTSW 2 136002594 missense probably benign 0.01
R2250:Plcb4 UTSW 2 135971861 critical splice donor site probably null
R2291:Plcb4 UTSW 2 135939983 missense probably benign 0.08
R2326:Plcb4 UTSW 2 135939973 missense probably damaging 0.99
R2442:Plcb4 UTSW 2 135950382 missense probably damaging 1.00
R2939:Plcb4 UTSW 2 135939203 splice site probably benign
R3774:Plcb4 UTSW 2 135958145 missense probably benign 0.00
R3875:Plcb4 UTSW 2 136002632 missense probably damaging 0.99
R4594:Plcb4 UTSW 2 136002599 missense probably damaging 0.98
R4673:Plcb4 UTSW 2 135932271 missense possibly damaging 0.68
R4812:Plcb4 UTSW 2 136007881 missense probably damaging 1.00
R5084:Plcb4 UTSW 2 136002651 missense probably damaging 1.00
R5468:Plcb4 UTSW 2 135967152 missense probably damaging 1.00
R5498:Plcb4 UTSW 2 135976172 missense probably damaging 1.00
R5923:Plcb4 UTSW 2 135961814 nonsense probably null
R6241:Plcb4 UTSW 2 135910174 missense possibly damaging 0.80
R6492:Plcb4 UTSW 2 135973071 nonsense probably null
R6514:Plcb4 UTSW 2 135954996 missense probably benign 0.22
R6570:Plcb4 UTSW 2 135982986 missense probably benign 0.13
R6721:Plcb4 UTSW 2 135910237 missense probably benign 0.01
R6915:Plcb4 UTSW 2 135947115 missense possibly damaging 0.84
R6991:Plcb4 UTSW 2 135910194 missense probably damaging 1.00
R7086:Plcb4 UTSW 2 136007847 missense probably benign
R7114:Plcb4 UTSW 2 135982123 critical splice donor site probably null
R7249:Plcb4 UTSW 2 136007821 critical splice acceptor site probably null
R7264:Plcb4 UTSW 2 135965080 missense probably benign
R7361:Plcb4 UTSW 2 135976148 missense possibly damaging 0.82
R7426:Plcb4 UTSW 2 136000219 missense probably benign 0.00
R7429:Plcb4 UTSW 2 135968322 missense probably damaging 1.00
R7430:Plcb4 UTSW 2 135968322 missense probably damaging 1.00
R8010:Plcb4 UTSW 2 135907560 missense probably benign 0.00
R8141:Plcb4 UTSW 2 135939249 missense probably damaging 1.00
R9072:Plcb4 UTSW 2 136007875 missense possibly damaging 0.93
R9119:Plcb4 UTSW 2 135967952 missense probably damaging 1.00
R9287:Plcb4 UTSW 2 135987897 missense probably benign 0.00
Z1177:Plcb4 UTSW 2 135958738 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCCATGTTTTGCTCAGTGC -3'
(R):5'- ATTATGTCATAGCCGGGTGG -3'

Sequencing Primer
(F):5'- CATAGGCCTCTCGGTTAAATTTG -3'
(R):5'- CCGGGTGGGCCTTTGAC -3'
Posted On 2019-05-13