Incidental Mutation 'R7040:Naa15'
ID 546983
Institutional Source Beutler Lab
Gene Symbol Naa15
Ensembl Gene ENSMUSG00000063273
Gene Name N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Synonyms tubedown, ASTBDN, Tbdn-1, mNAT1, 5730450D16Rik, Narg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 51415148-51476507 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 51472784 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 811 (L811Q)
Ref Sequence ENSEMBL: ENSMUSP00000141433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029303] [ENSMUST00000193266]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000029303
AA Change: L861Q

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029303
Gene: ENSMUSG00000063273
AA Change: L861Q

DomainStartEndE-ValueType
TPR 46 79 6.24e1 SMART
TPR 80 113 1.01e0 SMART
Blast:TPR 224 257 3e-12 BLAST
TPR 374 407 1.87e1 SMART
TPR 408 441 5.06e1 SMART
low complexity region 603 641 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193266
AA Change: L811Q

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141433
Gene: ENSMUSG00000063273
AA Change: L811Q

DomainStartEndE-ValueType
Blast:TPR 1 29 3e-10 BLAST
TPR 30 63 4.9e-3 SMART
Blast:TPR 174 207 3e-12 BLAST
TPR 324 357 8.9e-2 SMART
TPR 358 391 2.4e-1 SMART
coiled coil region 533 585 N/A INTRINSIC
Blast:TPR 622 655 7e-10 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-alpha-acetylation is among the most common post-translational protein modifications in eukaryotic cells. This process involves the transfer of an acetyl group from acetyl-coenzyme A to the alpha-amino group on a nascent polypeptide and is essential for normal cell function. This gene encodes the auxillary subunit of the N-terminal acetyltransferase A (NatA) complex. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Naa15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Naa15 APN 3 51438405 missense probably damaging 1.00
IGL01753:Naa15 APN 3 51442853 missense probably damaging 1.00
IGL01837:Naa15 APN 3 51443948 nonsense probably null
IGL02619:Naa15 APN 3 51460131 missense probably benign 0.03
IGL02691:Naa15 APN 3 51451326 missense probably damaging 0.97
IGL02974:Naa15 APN 3 51461207 missense possibly damaging 0.95
R0009:Naa15 UTSW 3 51470219 missense probably damaging 1.00
R0010:Naa15 UTSW 3 51436213 critical splice acceptor site probably null
R0114:Naa15 UTSW 3 51448438 critical splice donor site probably null
R0411:Naa15 UTSW 3 51465639 missense possibly damaging 0.81
R1348:Naa15 UTSW 3 51465670 missense probably damaging 1.00
R1941:Naa15 UTSW 3 51455934 nonsense probably null
R3082:Naa15 UTSW 3 51460050 missense probably damaging 1.00
R4377:Naa15 UTSW 3 51448365 missense possibly damaging 0.91
R4591:Naa15 UTSW 3 51441924 missense probably damaging 1.00
R4980:Naa15 UTSW 3 51458752 critical splice donor site probably null
R5087:Naa15 UTSW 3 51457285 splice site probably null
R5139:Naa15 UTSW 3 51443840 missense probably damaging 1.00
R5289:Naa15 UTSW 3 51455894 missense probably damaging 1.00
R5527:Naa15 UTSW 3 51441947 missense probably damaging 1.00
R5776:Naa15 UTSW 3 51460026 missense probably damaging 0.96
R5909:Naa15 UTSW 3 51460064 missense probably damaging 1.00
R6034:Naa15 UTSW 3 51442821 missense probably damaging 0.98
R6034:Naa15 UTSW 3 51442821 missense probably damaging 0.98
R6194:Naa15 UTSW 3 51463300 missense probably benign 0.00
R6291:Naa15 UTSW 3 51442791 missense probably damaging 1.00
R6522:Naa15 UTSW 3 51471514 missense probably damaging 1.00
R6731:Naa15 UTSW 3 51455873 missense probably damaging 1.00
R6984:Naa15 UTSW 3 51472600 missense probably benign 0.10
R7091:Naa15 UTSW 3 51458756 splice site probably null
R7380:Naa15 UTSW 3 51459847 splice site probably null
R7685:Naa15 UTSW 3 51469974 splice site probably null
R7781:Naa15 UTSW 3 51471483 critical splice acceptor site probably null
R7797:Naa15 UTSW 3 51448610 missense probably damaging 0.99
R7836:Naa15 UTSW 3 51463267 nonsense probably null
R7981:Naa15 UTSW 3 51458671 missense probably damaging 0.96
R8513:Naa15 UTSW 3 51460023 missense probably damaging 0.99
R8923:Naa15 UTSW 3 51460022 missense probably damaging 1.00
R9159:Naa15 UTSW 3 51451381 missense probably benign 0.01
X0020:Naa15 UTSW 3 51470132 missense probably benign 0.00
X0061:Naa15 UTSW 3 51448600 missense probably damaging 1.00
X0061:Naa15 UTSW 3 51448601 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CCTTGTGTTGTGACATGAGCC -3'
(R):5'- TCTGCCACACACCTGCTATG -3'

Sequencing Primer
(F):5'- GACATGAGCCTTTCTGTTCTTTAGAC -3'
(R):5'- TTAAACCCCTCAATTTTAGCAGC -3'
Posted On 2019-05-13