Incidental Mutation 'R7040:Grhpr'
ID 546985
Institutional Source Beutler Lab
Gene Symbol Grhpr
Ensembl Gene ENSMUSG00000035637
Gene Name glyoxylate reductase/hydroxypyruvate reductase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 44981395-44990734 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44985362 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 101 (S101G)
Ref Sequence ENSEMBL: ENSMUSP00000120254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045078] [ENSMUST00000128973] [ENSMUST00000151148] [ENSMUST00000151631]
AlphaFold Q91Z53
Predicted Effect probably damaging
Transcript: ENSMUST00000045078
AA Change: S154G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047218
Gene: ENSMUSG00000035637
AA Change: S154G

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 9 327 1.4e-28 PFAM
Pfam:2-Hacid_dh_C 116 295 1.3e-59 PFAM
Pfam:NAD_binding_2 153 272 3.4e-8 PFAM
Pfam:F420_oxidored 155 244 3.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128973
Predicted Effect probably damaging
Transcript: ENSMUST00000151148
AA Change: S101G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120254
Gene: ENSMUSG00000035637
AA Change: S101G

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 10 207 4.5e-15 PFAM
Pfam:2-Hacid_dh_C 63 222 2.2e-51 PFAM
Pfam:NAD_binding_2 100 219 3.3e-9 PFAM
Pfam:F420_oxidored 102 191 5.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000151631
AA Change: S148G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117800
Gene: ENSMUSG00000035637
AA Change: S148G

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 3 191 1.7e-24 PFAM
Pfam:2-Hacid_dh_C 110 196 7.4e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the D-isomer specific 2-hydroxyacid dehydrogenase family of proteins. The encoded protein catalyzes three enzymatic reactions: the conversion of hydroxypyruvate to D-glycerate as well as the reverse reaction, and the conversion of glyoxylate to glycolate. Homozygous knockout mice exhibit elevated synthesis of oxalate and glycerate. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit primary hyperoxaluria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Grhpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Grhpr APN 4 44988991 missense probably damaging 1.00
IGL01330:Grhpr APN 4 44986375 missense probably benign 0.00
IGL03104:Grhpr APN 4 44983867 splice site probably benign
R0054:Grhpr UTSW 4 44988915 unclassified probably benign
R0054:Grhpr UTSW 4 44988915 unclassified probably benign
R1257:Grhpr UTSW 4 44989045 missense probably damaging 1.00
R1802:Grhpr UTSW 4 44988950 nonsense probably null
R5348:Grhpr UTSW 4 44985393 missense probably damaging 1.00
R7002:Grhpr UTSW 4 44990427 missense probably damaging 0.99
R7362:Grhpr UTSW 4 44987255 missense probably benign 0.01
R7733:Grhpr UTSW 4 44981494 start gained probably benign
R7989:Grhpr UTSW 4 44989008 missense probably damaging 1.00
R9354:Grhpr UTSW 4 44981465 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCATTCATTTGTCAGCCAC -3'
(R):5'- GTAGATGAACCCTGGCTCTC -3'

Sequencing Primer
(F):5'- ACCTTTGCCCTATGACCTGGAAG -3'
(R):5'- CTCCGGCAAACCAGAGTTCTG -3'
Posted On 2019-05-13