Incidental Mutation 'R7040:Olfr1337'
ID 546987
Institutional Source Beutler Lab
Gene Symbol Olfr1337
Ensembl Gene ENSMUSG00000111159
Gene Name olfactory receptor 1337
Synonyms GA_x6K02T2QD9B-18767132-18768073, Olfr219-ps1, GA_x6K02SYWGW3-414-3, MOR259-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 118781636-118782586 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118781986 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 200 (M200V)
Ref Sequence ENSEMBL: ENSMUSP00000076483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077247]
AlphaFold A2ACY8
Predicted Effect probably benign
Transcript: ENSMUST00000077247
AA Change: M200V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076483
Gene: ENSMUSG00000111159
AA Change: M200V

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 7.8e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 308 8.5e-7 PFAM
Pfam:7tm_1 44 293 8.3e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Olfr1337
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02203:Olfr1337 APN 4 118782429 missense possibly damaging 0.95
IGL02626:Olfr1337 APN 4 118782334 missense probably damaging 0.98
IGL02699:Olfr1337 APN 4 118782152 nonsense probably null
IGL02754:Olfr1337 APN 4 118781920 missense possibly damaging 0.90
IGL03287:Olfr1337 APN 4 118782354 missense possibly damaging 0.64
R1341:Olfr1337 UTSW 4 118782382 missense probably benign 0.01
R4894:Olfr1337 UTSW 4 118782286 missense probably damaging 1.00
R6124:Olfr1337 UTSW 4 118782195 missense probably damaging 1.00
R6515:Olfr1337 UTSW 4 118782270 missense probably benign 0.13
R6529:Olfr1337 UTSW 4 118781710 missense probably benign 0.15
R7398:Olfr1337 UTSW 4 118781699 missense possibly damaging 0.80
R7684:Olfr1337 UTSW 4 118782274 missense probably benign 0.40
R8377:Olfr1337 UTSW 4 118782006 missense probably benign 0.22
R8717:Olfr1337 UTSW 4 118781799 missense probably damaging 1.00
R9369:Olfr1337 UTSW 4 118781880 missense probably benign 0.31
Z1189:Olfr1337 UTSW 4 118782087 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGCTGGAGTTTGGCCTCATG -3'
(R):5'- TATACTGTCATCCTCAACTGGGG -3'

Sequencing Primer
(F):5'- GCCTCATGTAGATGTAACTGGC -3'
(R):5'- CTCAACTGGGGCTTGTGCATAC -3'
Posted On 2019-05-13