Incidental Mutation 'R7040:Lrrc47'
ID 546989
Institutional Source Beutler Lab
Gene Symbol Lrrc47
Ensembl Gene ENSMUSG00000029028
Gene Name leucine rich repeat containing 47
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 154011731-154021513 bp(+) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) T to A at 154020452 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Arginine at position 123 (*123R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030894] [ENSMUST00000125533] [ENSMUST00000126119] [ENSMUST00000130175] [ENSMUST00000131325] [ENSMUST00000132541] [ENSMUST00000139569] [ENSMUST00000143047] [ENSMUST00000145527] [ENSMUST00000146054] [ENSMUST00000146426] [ENSMUST00000146543] [ENSMUST00000169622] [ENSMUST00000182151] [ENSMUST00000182191]
AlphaFold Q505F5
Predicted Effect probably benign
Transcript: ENSMUST00000030894
SMART Domains Protein: ENSMUSP00000030894
Gene: ENSMUSG00000029028

DomainStartEndE-ValueType
low complexity region 1 7 N/A INTRINSIC
low complexity region 10 36 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
LRR_TYP 100 123 2.61e-4 SMART
LRR_TYP 130 153 2.12e-4 SMART
LRR 155 177 3.75e0 SMART
LRR 180 202 9.77e1 SMART
LRR_TYP 203 226 2.27e-4 SMART
low complexity region 261 272 N/A INTRINSIC
low complexity region 277 292 N/A INTRINSIC
B3_4 331 507 8.94e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125533
SMART Domains Protein: ENSMUSP00000138324
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126119
SMART Domains Protein: ENSMUSP00000138560
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130175
SMART Domains Protein: ENSMUSP00000138675
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131325
SMART Domains Protein: ENSMUSP00000138777
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132541
SMART Domains Protein: ENSMUSP00000138471
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139569
Predicted Effect probably benign
Transcript: ENSMUST00000143047
SMART Domains Protein: ENSMUSP00000138733
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145527
SMART Domains Protein: ENSMUSP00000138448
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146054
SMART Domains Protein: ENSMUSP00000138605
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146426
Predicted Effect probably benign
Transcript: ENSMUST00000146543
SMART Domains Protein: ENSMUSP00000138267
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167947
AA Change: *123R
SMART Domains Protein: ENSMUSP00000131382
Gene: ENSMUSG00000029028
AA Change: *123R

DomainStartEndE-ValueType
Pfam:B3_4 1 54 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163672
Predicted Effect probably benign
Transcript: ENSMUST00000169622
SMART Domains Protein: ENSMUSP00000133124
Gene: ENSMUSG00000029028

DomainStartEndE-ValueType
low complexity region 22 29 N/A INTRINSIC
low complexity region 32 58 N/A INTRINSIC
low complexity region 65 76 N/A INTRINSIC
LRR_TYP 122 145 2.61e-4 SMART
LRR_TYP 152 175 2.12e-4 SMART
LRR 177 199 3.75e0 SMART
LRR 202 224 9.77e1 SMART
LRR_TYP 225 248 2.27e-4 SMART
low complexity region 283 294 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
B3_4 353 529 8.94e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182151
SMART Domains Protein: ENSMUSP00000138692
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182191
SMART Domains Protein: ENSMUSP00000138710
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Lrrc47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02502:Lrrc47 APN 4 154016014 missense probably benign 0.01
IGL02614:Lrrc47 APN 4 154018935 splice site probably null
IGL03001:Lrrc47 APN 4 154015993 missense probably damaging 0.99
R0372:Lrrc47 UTSW 4 154019632 missense probably benign 0.00
R0433:Lrrc47 UTSW 4 154018365 unclassified probably benign
R0720:Lrrc47 UTSW 4 154019887 splice site probably null
R1163:Lrrc47 UTSW 4 154011817 start codon destroyed probably null
R2078:Lrrc47 UTSW 4 154019431 missense probably damaging 1.00
R2103:Lrrc47 UTSW 4 154015893 missense probably damaging 1.00
R5105:Lrrc47 UTSW 4 154012216 missense probably damaging 1.00
R5109:Lrrc47 UTSW 4 154017476 missense probably damaging 0.99
R5687:Lrrc47 UTSW 4 154015683 missense probably benign 0.10
R5885:Lrrc47 UTSW 4 154015972 missense possibly damaging 0.75
R6198:Lrrc47 UTSW 4 154015672 missense probably damaging 1.00
R6384:Lrrc47 UTSW 4 154015860 missense probably benign 0.00
R7680:Lrrc47 UTSW 4 154016101 missense probably benign 0.00
R8263:Lrrc47 UTSW 4 154016029 missense probably damaging 1.00
R9092:Lrrc47 UTSW 4 154011964 missense possibly damaging 0.79
R9364:Lrrc47 UTSW 4 154015941 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGATGTCTGTGTAGGTGTGGAT -3'
(R):5'- GTTCCAAGCACAGCCGTG -3'

Sequencing Primer
(F):5'- AGGTGTGGATATGCTGTAGGTATC -3'
(R):5'- GATGTTCTCAACTGTCTATGCACAG -3'
Posted On 2019-05-13