Incidental Mutation 'R0611:Akap9'
ID54699
Institutional Source Beutler Lab
Gene Symbol Akap9
Ensembl Gene ENSMUSG00000040407
Gene NameA kinase (PRKA) anchor protein (yotiao) 9
SynonymsAKAP450, G1-448-15, 5730481H23Rik, mei2-5, repro12
MMRRC Submission 038800-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R0611 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location3928054-4081310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3954870 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 148 (K148E)
Ref Sequence ENSEMBL: ENSMUSP00000117209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044492] [ENSMUST00000143365]
Predicted Effect probably benign
Transcript: ENSMUST00000044492
AA Change: K130E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000046129
Gene: ENSMUSG00000040407
AA Change: K130E

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 98 115 N/A INTRINSIC
Blast:HPT 126 197 6e-21 BLAST
low complexity region 237 249 N/A INTRINSIC
low complexity region 297 315 N/A INTRINSIC
coiled coil region 404 593 N/A INTRINSIC
coiled coil region 622 756 N/A INTRINSIC
coiled coil region 777 843 N/A INTRINSIC
coiled coil region 888 958 N/A INTRINSIC
low complexity region 982 997 N/A INTRINSIC
coiled coil region 1037 1065 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
internal_repeat_2 1247 1312 7.75e-5 PROSPERO
internal_repeat_1 1377 1485 2.63e-5 PROSPERO
coiled coil region 1522 1589 N/A INTRINSIC
coiled coil region 1789 2107 N/A INTRINSIC
coiled coil region 2132 2318 N/A INTRINSIC
internal_repeat_1 2322 2445 2.63e-5 PROSPERO
coiled coil region 2455 2494 N/A INTRINSIC
low complexity region 2587 2598 N/A INTRINSIC
low complexity region 2627 2640 N/A INTRINSIC
internal_repeat_2 2934 2997 7.75e-5 PROSPERO
low complexity region 3000 3016 N/A INTRINSIC
coiled coil region 3109 3307 N/A INTRINSIC
coiled coil region 3455 3493 N/A INTRINSIC
coiled coil region 3521 3556 N/A INTRINSIC
Pfam:PACT_coil_coil 3576 3657 1.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140977
Predicted Effect probably benign
Transcript: ENSMUST00000143365
AA Change: K148E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117209
Gene: ENSMUSG00000040407
AA Change: K148E

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Blast:HPT 144 215 9e-22 BLAST
low complexity region 255 267 N/A INTRINSIC
low complexity region 315 333 N/A INTRINSIC
coiled coil region 422 571 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198973
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a chemically induced allele exhibit male infertily with abnormal spermatogenesis and Sertoli maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,252,256 M819K possibly damaging Het
Adamtsl3 T G 7: 82,528,912 C528G probably damaging Het
Akr1b3 A T 6: 34,309,642 D225E probably benign Het
Alms1 C A 6: 85,678,671 Q2931K possibly damaging Het
Ano3 T C 2: 110,885,001 K31E possibly damaging Het
Cdc37 A G 9: 21,142,241 I242T probably damaging Het
Celsr1 T A 15: 85,932,323 K1806N possibly damaging Het
Clpb T A 7: 101,787,749 I707N possibly damaging Het
Cntnap2 A T 6: 47,095,549 Y1017F possibly damaging Het
Creb3l2 A T 6: 37,334,481 S458T probably benign Het
Ctnnd2 C A 15: 31,009,084 T1109K possibly damaging Het
Dcaf10 T A 4: 45,373,011 L425Q probably damaging Het
Dlec1 A G 9: 119,112,099 E239G probably benign Het
Dnah2 T C 11: 69,499,194 K742E probably damaging Het
Dsp A T 13: 38,187,741 R889S probably damaging Het
Dync1h1 T A 12: 110,632,788 M1859K probably damaging Het
Efcab7 T A 4: 99,901,689 N361K probably damaging Het
Eps8l2 T C 7: 141,355,733 V139A probably damaging Het
Fads3 T G 19: 10,041,836 H35Q probably damaging Het
Fam163b C A 2: 27,113,571 V24F probably damaging Het
Gm14496 A T 2: 181,995,111 T121S probably benign Het
Gm4799 C T 10: 82,954,729 noncoding transcript Het
Gm7168 A T 17: 13,949,535 D388V probably benign Het
Gmeb1 A T 4: 132,226,075 L460* probably null Het
Gpc6 T G 14: 117,975,018 F534V probably null Het
Hectd3 A G 4: 116,996,044 D156G possibly damaging Het
Itga6 T C 2: 71,820,060 I150T possibly damaging Het
Kansl1 A G 11: 104,338,186 M863T probably benign Het
Kcnb2 A T 1: 15,710,440 Y512F probably benign Het
Klhdc2 A T 12: 69,300,279 M73L probably benign Het
Ktn1 A G 14: 47,694,616 T667A probably benign Het
Lgsn A C 1: 31,203,655 I273L probably benign Het
Lilra5 A G 7: 4,242,233 D292G probably benign Het
Mrps27 C T 13: 99,405,074 R229C probably damaging Het
Muc5b T G 7: 141,862,436 S3040A probably benign Het
Nat14 T C 7: 4,923,276 S7P probably damaging Het
Nfia A G 4: 97,783,457 I135V possibly damaging Het
Nkd1 G A 8: 88,522,316 A30T probably damaging Het
Nup205 A G 6: 35,225,968 D1370G probably null Het
Olfr282 T C 15: 98,438,287 S273P possibly damaging Het
Olfr344 C G 2: 36,569,556 probably null Het
Olfr507 T A 7: 108,622,287 N158K possibly damaging Het
Olfr633 T C 7: 103,947,193 L209P probably damaging Het
Olfr726 G A 14: 50,083,853 T276I probably damaging Het
Orc1 C T 4: 108,602,032 A466V probably benign Het
Otud7a T A 7: 63,735,890 D367E possibly damaging Het
Pcdhb4 A G 18: 37,308,210 Y191C probably damaging Het
Pclo T C 5: 14,678,775 probably benign Het
Pclo T C 5: 14,712,814 V3767A unknown Het
Prmt1 A T 7: 44,978,801 probably null Het
Ralgapa1 A G 12: 55,795,698 F62S probably damaging Het
Rangrf T C 11: 68,972,692 S163G probably benign Het
Rgs12 C A 5: 35,019,460 A65E probably damaging Het
Rrbp1 T C 2: 143,988,516 N577S probably damaging Het
Sept11 A G 5: 93,167,534 H374R probably damaging Het
Serpina5 T G 12: 104,103,787 N314K probably benign Het
Sgce T C 6: 4,689,621 D395G probably damaging Het
Slc26a9 A T 1: 131,762,761 N501I probably damaging Het
Slc9c1 A G 16: 45,581,602 D784G possibly damaging Het
Snapc2 A G 8: 4,255,676 D207G probably benign Het
Stard9 G T 2: 120,699,257 M1998I probably benign Het
Stk38 A C 17: 28,975,933 F280V possibly damaging Het
Tas2r126 A G 6: 42,435,091 K186R probably damaging Het
Tdp1 A C 12: 99,909,711 D307A probably benign Het
Tead2 A G 7: 45,217,250 D11G probably damaging Het
Tmco4 C A 4: 139,020,072 L211I probably damaging Het
Tmem183a A G 1: 134,352,377 F255S probably damaging Het
Tmem87a C T 2: 120,375,448 G349S possibly damaging Het
Tpte G A 8: 22,336,533 E377K possibly damaging Het
Trim32 T C 4: 65,613,656 F150S possibly damaging Het
Trpc7 T A 13: 56,887,823 K99M probably damaging Het
Ttc22 A G 4: 106,634,184 K195E probably damaging Het
Txn2 G A 15: 77,927,717 P7S probably damaging Het
Ubxn2a G A 12: 4,880,700 T220I probably damaging Het
Ufd1 A G 16: 18,814,876 N17S possibly damaging Het
Unc13a A G 8: 71,649,865 S958P probably damaging Het
Vmn1r202 T A 13: 22,501,654 M198L probably damaging Het
Vmn2r84 G A 10: 130,386,122 A743V probably damaging Het
Washc5 A G 15: 59,341,158 F891S probably damaging Het
Zfp708 T C 13: 67,070,311 T495A probably benign Het
Zfp81 A G 17: 33,334,619 I407T probably benign Het
Zswim5 T C 4: 116,986,677 probably null Het
Other mutations in Akap9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Akap9 APN 5 4046639 missense probably damaging 0.97
IGL00642:Akap9 APN 5 3960842 missense probably damaging 0.99
IGL00786:Akap9 APN 5 4070522 missense probably damaging 1.00
IGL00788:Akap9 APN 5 4060480 missense probably damaging 1.00
IGL00969:Akap9 APN 5 4001550 missense probably benign
IGL01014:Akap9 APN 5 3968683 missense probably benign 0.41
IGL01302:Akap9 APN 5 3970711 missense probably benign 0.27
IGL01610:Akap9 APN 5 4032839 missense possibly damaging 0.95
IGL01620:Akap9 APN 5 3960218 missense probably benign 0.11
IGL01862:Akap9 APN 5 3951705 missense probably damaging 0.99
IGL01862:Akap9 APN 5 4065856 missense probably damaging 0.99
IGL02151:Akap9 APN 5 4032728 nonsense probably null
IGL02635:Akap9 APN 5 4070500 missense possibly damaging 0.59
IGL02858:Akap9 APN 5 4069130 missense possibly damaging 0.88
IGL02967:Akap9 APN 5 3976164 missense probably benign 0.07
IGL03064:Akap9 APN 5 3968755 missense probably damaging 1.00
IGL03289:Akap9 APN 5 4077261 missense probably damaging 1.00
wee_one UTSW 5 4043925 missense probably damaging 1.00
FR4449:Akap9 UTSW 5 3981214 unclassified probably benign
PIT1430001:Akap9 UTSW 5 4029849 missense probably damaging 1.00
PIT4366001:Akap9 UTSW 5 4046221 missense probably benign 0.24
R0088:Akap9 UTSW 5 3961946 missense probably benign 0.22
R0309:Akap9 UTSW 5 4069038 missense probably benign 0.01
R0387:Akap9 UTSW 5 3951678 splice site probably benign
R0440:Akap9 UTSW 5 4064569 missense probably damaging 0.99
R0441:Akap9 UTSW 5 3961714 missense probably benign 0.15
R0491:Akap9 UTSW 5 3972851 unclassified probably benign
R0501:Akap9 UTSW 5 3970685 missense probably damaging 1.00
R0507:Akap9 UTSW 5 4069043 missense probably benign 0.41
R0544:Akap9 UTSW 5 4069185 missense probably benign 0.22
R0581:Akap9 UTSW 5 4050620 missense probably benign 0.03
R0620:Akap9 UTSW 5 4064136 missense probably damaging 0.98
R0639:Akap9 UTSW 5 4060318 missense probably damaging 1.00
R0932:Akap9 UTSW 5 4046492 missense possibly damaging 0.77
R0944:Akap9 UTSW 5 4064742 synonymous probably null
R1101:Akap9 UTSW 5 4046205 missense probably benign 0.00
R1159:Akap9 UTSW 5 3960865 missense probably damaging 0.98
R1170:Akap9 UTSW 5 4055671 missense probably benign
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1185:Akap9 UTSW 5 3948783 missense probably benign 0.13
R1453:Akap9 UTSW 5 3975614 unclassified probably null
R1551:Akap9 UTSW 5 4069174 missense probably benign 0.02
R1608:Akap9 UTSW 5 3961783 missense probably damaging 1.00
R1652:Akap9 UTSW 5 4077210 missense probably damaging 1.00
R1659:Akap9 UTSW 5 4064633 missense probably damaging 1.00
R1713:Akap9 UTSW 5 4039345 critical splice donor site probably null
R1719:Akap9 UTSW 5 3957645 nonsense probably null
R1720:Akap9 UTSW 5 3972791 missense possibly damaging 0.63
R1757:Akap9 UTSW 5 4001667 missense probably benign 0.41
R1872:Akap9 UTSW 5 4001406 missense probably damaging 1.00
R1876:Akap9 UTSW 5 3961809 missense probably benign 0.28
R1881:Akap9 UTSW 5 4050173 missense probably benign
R1950:Akap9 UTSW 5 3960677 missense probably damaging 1.00
R1980:Akap9 UTSW 5 3972771 missense probably damaging 0.99
R1993:Akap9 UTSW 5 4038520 splice site probably null
R2008:Akap9 UTSW 5 3960131 missense possibly damaging 0.47
R2020:Akap9 UTSW 5 3961967 missense probably damaging 1.00
R2051:Akap9 UTSW 5 3975685 nonsense probably null
R2061:Akap9 UTSW 5 3961010 missense probably damaging 1.00
R2109:Akap9 UTSW 5 4044847 missense possibly damaging 0.47
R2135:Akap9 UTSW 5 4064509 missense probably damaging 1.00
R2225:Akap9 UTSW 5 4077271 missense probably damaging 0.96
R2232:Akap9 UTSW 5 4046603 missense probably damaging 1.00
R2424:Akap9 UTSW 5 4065279 missense probably damaging 0.97
R2483:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R2879:Akap9 UTSW 5 3976353 intron probably benign
R3622:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3623:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3624:Akap9 UTSW 5 3976235 missense possibly damaging 0.65
R3722:Akap9 UTSW 5 4070351 missense probably damaging 1.00
R3806:Akap9 UTSW 5 3954410 missense probably benign 0.00
R3919:Akap9 UTSW 5 3961764 nonsense probably null
R4023:Akap9 UTSW 5 3992077 missense possibly damaging 0.66
R4093:Akap9 UTSW 5 4043996 missense probably damaging 0.99
R4434:Akap9 UTSW 5 4032708 missense probably damaging 0.99
R4529:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4530:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4532:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4533:Akap9 UTSW 5 4043948 missense probably damaging 1.00
R4585:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4586:Akap9 UTSW 5 3976151 missense probably benign 0.00
R4655:Akap9 UTSW 5 4046403 missense probably benign 0.14
R4676:Akap9 UTSW 5 4032774 missense probably damaging 1.00
R4676:Akap9 UTSW 5 4064515 nonsense probably null
R4724:Akap9 UTSW 5 4055339 missense probably benign
R4731:Akap9 UTSW 5 3962266 missense possibly damaging 0.54
R4732:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4733:Akap9 UTSW 5 4013901 missense probably damaging 0.98
R4743:Akap9 UTSW 5 3961013 missense probably damaging 1.00
R4749:Akap9 UTSW 5 3968737 missense probably benign 0.41
R4756:Akap9 UTSW 5 4001418 missense probably damaging 0.99
R4757:Akap9 UTSW 5 4008382 missense probably damaging 1.00
R4860:Akap9 UTSW 5 4034916 intron probably benign
R4937:Akap9 UTSW 5 4050145 splice site probably null
R4960:Akap9 UTSW 5 3957664 missense probably benign 0.15
R4974:Akap9 UTSW 5 3961466 missense possibly damaging 0.81
R5101:Akap9 UTSW 5 4001748 missense probably damaging 0.96
R5160:Akap9 UTSW 5 4030007 missense probably damaging 1.00
R5200:Akap9 UTSW 5 3960734 missense probably benign 0.00
R5245:Akap9 UTSW 5 3976209 missense probably damaging 0.99
R5293:Akap9 UTSW 5 3948687 missense probably damaging 0.99
R5408:Akap9 UTSW 5 4058458 missense possibly damaging 0.84
R5507:Akap9 UTSW 5 3968683 missense probably benign 0.41
R5517:Akap9 UTSW 5 4001665 missense possibly damaging 0.76
R5579:Akap9 UTSW 5 4064714 missense possibly damaging 0.93
R5619:Akap9 UTSW 5 3954760 intron probably benign
R5645:Akap9 UTSW 5 4050590 missense probably benign 0.09
R5669:Akap9 UTSW 5 4050540 nonsense probably null
R5686:Akap9 UTSW 5 3971926 missense probably benign 0.00
R5697:Akap9 UTSW 5 3960170 missense possibly damaging 0.92
R5821:Akap9 UTSW 5 4046064 missense probably benign 0.13
R5875:Akap9 UTSW 5 4077285 missense probably benign 0.01
R5897:Akap9 UTSW 5 4077904 missense probably benign 0.23
R5999:Akap9 UTSW 5 4043925 missense probably damaging 1.00
R6025:Akap9 UTSW 5 4032801 missense probably damaging 1.00
R6078:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6138:Akap9 UTSW 5 4067924 critical splice donor site probably null
R6225:Akap9 UTSW 5 3962105 missense probably damaging 1.00
R6243:Akap9 UTSW 5 4065000 intron probably null
R6326:Akap9 UTSW 5 3962061 missense probably damaging 1.00
R6564:Akap9 UTSW 5 4028491 missense probably damaging 0.98
R6617:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6625:Akap9 UTSW 5 3968745 missense probably benign 0.04
R6632:Akap9 UTSW 5 4013842 splice site probably null
R6677:Akap9 UTSW 5 4029869 missense probably benign 0.21
R6717:Akap9 UTSW 5 4064086 missense probably damaging 1.00
R6893:Akap9 UTSW 5 3961709 missense probably benign 0.32
R6915:Akap9 UTSW 5 3960551 missense probably benign 0.03
R6938:Akap9 UTSW 5 4046628 missense possibly damaging 0.91
R6972:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6973:Akap9 UTSW 5 4046699 missense possibly damaging 0.62
R6993:Akap9 UTSW 5 4065866 missense possibly damaging 0.65
R7032:Akap9 UTSW 5 3954896 missense probably benign
R7164:Akap9 UTSW 5 4060364 missense probably damaging 0.96
R7170:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7192:Akap9 UTSW 5 4005723 intron probably null
R7284:Akap9 UTSW 5 3956246 missense probably damaging 1.00
R7299:Akap9 UTSW 5 4032696 missense probably damaging 1.00
R7313:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7326:Akap9 UTSW 5 4045930 missense possibly damaging 0.47
R7343:Akap9 UTSW 5 4046364 missense probably damaging 0.99
R7455:Akap9 UTSW 5 3972792 missense probably benign 0.03
R7482:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7489:Akap9 UTSW 5 4004933 missense probably damaging 1.00
R7525:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7528:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7576:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7577:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7578:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7610:Akap9 UTSW 5 3957677 missense possibly damaging 0.95
R7658:Akap9 UTSW 5 3968745 missense probably benign 0.04
R7754:Akap9 UTSW 5 4046736 missense probably benign 0.03
R7818:Akap9 UTSW 5 4013875 nonsense probably null
U15987:Akap9 UTSW 5 4067924 critical splice donor site probably null
X0026:Akap9 UTSW 5 4014039 missense probably damaging 1.00
X0057:Akap9 UTSW 5 3975598 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGACTAACAGCCTTCTCTGCAT -3'
(R):5'- GTCACCATTCCAAAGCCCCGTATTA -3'

Sequencing Primer
(F):5'- TTGTAACAGAGTGCAGAAATCCTG -3'
(R):5'- TTCCAAAGCCCCGTATTAAAGAAC -3'
Posted On2013-07-11