Incidental Mutation 'R7040:Myo1h'
ID546990
Institutional Source Beutler Lab
Gene Symbol Myo1h
Ensembl Gene ENSMUSG00000066952
Gene Namemyosin 1H
Synonyms4631401O15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7040 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location114289166-114365357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114359744 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 53 (D53V)
Ref Sequence ENSEMBL: ENSMUSP00000144492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102581] [ENSMUST00000124316] [ENSMUST00000134532] [ENSMUST00000169347] [ENSMUST00000196467] [ENSMUST00000196676] [ENSMUST00000199567] [ENSMUST00000202006]
Predicted Effect probably benign
Transcript: ENSMUST00000102581
SMART Domains Protein: ENSMUSP00000099641
Gene: ENSMUSG00000001098

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
BTB 32 132 6.89e-19 SMART
low complexity region 286 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124316
SMART Domains Protein: ENSMUSP00000118824
Gene: ENSMUSG00000066952

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 833 1015 5.8e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134532
SMART Domains Protein: ENSMUSP00000138564
Gene: ENSMUSG00000001098

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:BTB_2 34 89 2.8e-7 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000132905
Gene: ENSMUSG00000066952
AA Change: D878V

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196467
AA Change: D53V

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144133
Gene: ENSMUSG00000066952
AA Change: D53V

DomainStartEndE-ValueType
Blast:MYSc 1 52 7e-10 BLAST
Pfam:Myosin_TH1 70 181 1.5e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196676
AA Change: D53V

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144682
Gene: ENSMUSG00000066952
AA Change: D53V

DomainStartEndE-ValueType
Pfam:Myosin_TH1 25 204 7.3e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199567
AA Change: D53V

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144492
Gene: ENSMUSG00000066952
AA Change: D53V

DomainStartEndE-ValueType
Pfam:Myosin_TH1 25 213 4.2e-26 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000144110
Gene: ENSMUSG00000066952
AA Change: D862V

DomainStartEndE-ValueType
MYSc 5 692 N/A SMART
IQ 693 715 1.21e1 SMART
IQ 716 738 6.6e-2 SMART
Pfam:Myosin_TH1 834 1013 2.3e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Myo1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myo1h APN 5 114315071 splice site probably benign
IGL00922:Myo1h APN 5 114360485 missense probably damaging 1.00
IGL01022:Myo1h APN 5 114336300 missense possibly damaging 0.67
IGL01364:Myo1h APN 5 114348439 missense probably damaging 1.00
IGL01469:Myo1h APN 5 114361269 missense probably damaging 1.00
IGL01626:Myo1h APN 5 114314966 missense probably damaging 1.00
IGL02026:Myo1h APN 5 114323444 missense probably null 0.07
IGL02156:Myo1h APN 5 114353911 splice site probably benign
IGL02164:Myo1h APN 5 114334096 missense probably damaging 1.00
IGL02429:Myo1h APN 5 114359738 splice site probably benign
IGL02562:Myo1h APN 5 114357992 missense probably benign 0.06
IGL02938:Myo1h APN 5 114358939 missense probably damaging 1.00
R0056:Myo1h UTSW 5 114330212 missense probably damaging 1.00
R0172:Myo1h UTSW 5 114329164 splice site probably null
R0346:Myo1h UTSW 5 114355209 missense probably benign 0.19
R0464:Myo1h UTSW 5 114360510 missense probably damaging 1.00
R0556:Myo1h UTSW 5 114319791 missense probably damaging 1.00
R0723:Myo1h UTSW 5 114319680 missense probably benign 0.20
R0751:Myo1h UTSW 5 114320686 missense probably damaging 1.00
R1470:Myo1h UTSW 5 114319704 missense probably damaging 0.99
R1470:Myo1h UTSW 5 114319704 missense probably damaging 0.99
R1579:Myo1h UTSW 5 114347435 nonsense probably null
R1646:Myo1h UTSW 5 114317632 missense possibly damaging 0.90
R1648:Myo1h UTSW 5 114336275 missense probably damaging 1.00
R1981:Myo1h UTSW 5 114353837 missense probably damaging 1.00
R2006:Myo1h UTSW 5 114361079 missense probably damaging 1.00
R2697:Myo1h UTSW 5 114355213 missense probably damaging 1.00
R3124:Myo1h UTSW 5 114328799 missense probably benign 0.04
R3195:Myo1h UTSW 5 114328740 missense probably benign
R4255:Myo1h UTSW 5 114330137 missense possibly damaging 0.89
R4613:Myo1h UTSW 5 114348379 missense possibly damaging 0.73
R4613:Myo1h UTSW 5 114351676 missense probably benign 0.02
R4758:Myo1h UTSW 5 114349582 missense probably damaging 1.00
R4784:Myo1h UTSW 5 114360599 missense possibly damaging 0.46
R4785:Myo1h UTSW 5 114360599 missense possibly damaging 0.46
R5511:Myo1h UTSW 5 114345897 nonsense probably null
R5663:Myo1h UTSW 5 114334094 missense probably damaging 1.00
R6186:Myo1h UTSW 5 114319803 missense possibly damaging 0.90
R6243:Myo1h UTSW 5 114362147 missense probably damaging 1.00
R6344:Myo1h UTSW 5 114328715 missense probably damaging 1.00
R6345:Myo1h UTSW 5 114351708 missense probably damaging 1.00
R6383:Myo1h UTSW 5 114336264 missense probably damaging 1.00
R6444:Myo1h UTSW 5 114314956 missense possibly damaging 0.63
R6787:Myo1h UTSW 5 114320653 missense probably damaging 1.00
R6891:Myo1h UTSW 5 114349612 missense probably damaging 1.00
R6990:Myo1h UTSW 5 114330160 missense probably damaging 0.97
R7101:Myo1h UTSW 5 114342197 missense
R7121:Myo1h UTSW 5 114338229 missense
R7206:Myo1h UTSW 5 114319775 nonsense probably null
R7222:Myo1h UTSW 5 114355261 critical splice donor site probably null
R7921:Myo1h UTSW 5 114328811 splice site probably null
R7979:Myo1h UTSW 5 114336311 splice site probably null
R8004:Myo1h UTSW 5 114320708 missense
Z1177:Myo1h UTSW 5 114334156 missense
Predicted Primers PCR Primer
(F):5'- TGGTCACGAGCGAGATATTC -3'
(R):5'- GTTAATGCCCTGAGTGGCAG -3'

Sequencing Primer
(F):5'- CTATGCAGAGAGCTTGAACCAACTG -3'
(R):5'- CTGAGTGGCAGGGGTGAGC -3'
Posted On2019-05-13