Incidental Mutation 'R7040:Palb2'
ID 546998
Institutional Source Beutler Lab
Gene Symbol Palb2
Ensembl Gene ENSMUSG00000044702
Gene Name partner and localizer of BRCA2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 122107262-122132985 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 122114399 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 524 (M524K)
Ref Sequence ENSEMBL: ENSMUSP00000102077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063587] [ENSMUST00000098068] [ENSMUST00000106468] [ENSMUST00000106469] [ENSMUST00000131657] [ENSMUST00000142952]
AlphaFold Q3U0P1
Predicted Effect probably benign
Transcript: ENSMUST00000063587
AA Change: M167K

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063514
Gene: ENSMUSG00000044702
AA Change: M167K

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
PDB:3EU7|A 36 383 N/A PDB
SCOP:d2bbkh_ 231 381 4e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098068
AA Change: M887K

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095675
Gene: ENSMUSG00000044702
AA Change: M887K

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Pfam:PALB2_WD40 755 1102 2.4e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106468
AA Change: M887K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102076
Gene: ENSMUSG00000044702
AA Change: M887K

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
PDB:3EU7|A 753 984 1e-131 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000106469
AA Change: M524K

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102077
Gene: ENSMUSG00000044702
AA Change: M524K

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
PDB:3EU7|A 390 740 N/A PDB
SCOP:d2bbkh_ 588 738 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131657
Predicted Effect probably benign
Transcript: ENSMUST00000142952
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may function in tumor suppression. This protein binds to and colocalizes with the breast cancer 2 early onset protein (BRCA2) in nuclear foci and likely permits the stable intranuclear localization and accumulation of BRCA2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality with impaired inner cell mass proliferation, impaired gastrulation, absence of the amnion, somites and tail bud, and general improper organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Palb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Palb2 APN 7 122121048 splice site probably benign
IGL00232:Palb2 APN 7 122121064 missense probably damaging 0.99
IGL02171:Palb2 APN 7 122107586 missense probably damaging 1.00
IGL03030:Palb2 APN 7 122113256 missense probably damaging 1.00
IGL03102:Palb2 APN 7 122124499 missense possibly damaging 0.88
R0128:Palb2 UTSW 7 122128166 nonsense probably null
R1192:Palb2 UTSW 7 122128209 missense probably benign 0.11
R1470:Palb2 UTSW 7 122107523 missense probably benign 0.01
R1470:Palb2 UTSW 7 122107524 nonsense probably null
R1470:Palb2 UTSW 7 122107523 missense probably benign 0.01
R1470:Palb2 UTSW 7 122107524 nonsense probably null
R1575:Palb2 UTSW 7 122110838 splice site probably null
R1664:Palb2 UTSW 7 122124392 utr 3 prime probably benign
R1852:Palb2 UTSW 7 122114314 missense possibly damaging 0.93
R1984:Palb2 UTSW 7 122127080 missense probably damaging 0.96
R2061:Palb2 UTSW 7 122124525 missense possibly damaging 0.86
R2121:Palb2 UTSW 7 122127781 missense possibly damaging 0.61
R2877:Palb2 UTSW 7 122114429 missense probably damaging 0.97
R2878:Palb2 UTSW 7 122114429 missense probably damaging 0.97
R3923:Palb2 UTSW 7 122117360 splice site probably null
R4609:Palb2 UTSW 7 122124723 missense probably benign 0.16
R4629:Palb2 UTSW 7 122127966 missense possibly damaging 0.89
R4678:Palb2 UTSW 7 122127366 missense probably damaging 0.99
R5111:Palb2 UTSW 7 122117305 nonsense probably null
R5381:Palb2 UTSW 7 122128413 missense probably benign 0.06
R5470:Palb2 UTSW 7 122114351 missense probably damaging 1.00
R5793:Palb2 UTSW 7 122127637 missense probably benign 0.05
R6160:Palb2 UTSW 7 122128420 splice site probably null
R6630:Palb2 UTSW 7 122124529 missense probably damaging 0.97
R6783:Palb2 UTSW 7 122127488 missense probably damaging 1.00
R6897:Palb2 UTSW 7 122127047 critical splice donor site probably null
R7121:Palb2 UTSW 7 122124834 missense probably benign 0.18
R7438:Palb2 UTSW 7 122117331 missense probably damaging 0.96
R7522:Palb2 UTSW 7 122113278 missense probably damaging 1.00
R7583:Palb2 UTSW 7 122127342 missense probably benign 0.15
R7679:Palb2 UTSW 7 122128014 missense probably benign 0.00
R7769:Palb2 UTSW 7 122128415 missense probably benign 0.11
R7802:Palb2 UTSW 7 122110896 splice site probably null
R8271:Palb2 UTSW 7 122124874 missense probably damaging 0.99
R8428:Palb2 UTSW 7 122112001 missense possibly damaging 0.54
R8725:Palb2 UTSW 7 122111661 missense unknown
R8927:Palb2 UTSW 7 122124598 missense probably damaging 1.00
R8928:Palb2 UTSW 7 122124598 missense probably damaging 1.00
X0060:Palb2 UTSW 7 122114478 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGCTGCAATGTGGCATTAAG -3'
(R):5'- TGTGTAGACTGACATCTGTGACTG -3'

Sequencing Primer
(F):5'- CAGAGATCAGGTTCCTAGGCATC -3'
(R):5'- ACTGACATCTGTGACTGAAGTTGC -3'
Posted On 2019-05-13