Incidental Mutation 'R7040:9130023H24Rik'
ID 546999
Institutional Source Beutler Lab
Gene Symbol 9130023H24Rik
Ensembl Gene ENSMUSG00000062944
Gene Name RIKEN cDNA 9130023H24 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 128234458-128238031 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 128236725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 232 (L232P)
Ref Sequence ENSEMBL: ENSMUSP00000077867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044660] [ENSMUST00000078816]
AlphaFold Q8BG98
Predicted Effect probably benign
Transcript: ENSMUST00000044660
SMART Domains Protein: ENSMUSP00000040568
Gene: ENSMUSG00000042178

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 62 104 N/A INTRINSIC
ARM 137 179 2.89e-1 SMART
ARM 180 221 3.32e-1 SMART
ARM 222 263 2.93e-2 SMART
Blast:ARM 265 306 1e-8 BLAST
low complexity region 313 338 N/A INTRINSIC
ARM 353 399 4.88e0 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 670 690 N/A INTRINSIC
Pfam:BTB 742 854 9.6e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078816
AA Change: L232P

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077867
Gene: ENSMUSG00000062944
AA Change: L232P

DomainStartEndE-ValueType
ZnF_C2H2 88 110 1.89e-1 SMART
ZnF_C2H2 116 138 7.49e-5 SMART
ZnF_C2H2 144 166 1.12e-3 SMART
ZnF_C2H2 172 194 2.4e-3 SMART
ZnF_C2H2 200 222 1.95e-3 SMART
ZnF_C2H2 228 250 3.89e-3 SMART
ZnF_C2H2 256 278 1.1e-2 SMART
ZnF_C2H2 284 306 1.33e-1 SMART
ZnF_C2H2 312 334 2.53e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in 9130023H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:9130023H24Rik APN 7 128237119 missense probably benign 0.01
IGL01865:9130023H24Rik APN 7 128236935 missense probably damaging 1.00
R0319:9130023H24Rik UTSW 7 128237190 missense probably benign
R1376:9130023H24Rik UTSW 7 128237010 missense probably benign 0.17
R1376:9130023H24Rik UTSW 7 128237010 missense probably benign 0.17
R2373:9130023H24Rik UTSW 7 128237315 missense probably benign 0.13
R4751:9130023H24Rik UTSW 7 128237086 missense probably benign 0.00
R5543:9130023H24Rik UTSW 7 128237181 missense probably benign
R5577:9130023H24Rik UTSW 7 128236654 missense probably damaging 1.00
R5726:9130023H24Rik UTSW 7 128236660 missense probably damaging 1.00
R5906:9130023H24Rik UTSW 7 128236492 missense probably benign 0.01
R6800:9130023H24Rik UTSW 7 128237570 start gained probably benign
R7529:9130023H24Rik UTSW 7 128237164 nonsense probably null
R7672:9130023H24Rik UTSW 7 128237019 missense probably damaging 1.00
R8863:9130023H24Rik UTSW 7 128236951 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGGTGAAGTTCTTGCCACACTC -3'
(R):5'- AACACCGTCGTTCTCACTCAG -3'

Sequencing Primer
(F):5'- CACAGCAATTGTAGGGCTTC -3'
(R):5'- TCACTCAGGTCTCCGGC -3'
Posted On 2019-05-13