Incidental Mutation 'R7040:Cd3d'
ID 547003
Institutional Source Beutler Lab
Gene Symbol Cd3d
Ensembl Gene ENSMUSG00000032094
Gene Name CD3 antigen, delta polypeptide
Synonyms T3d
MMRRC Submission 045013-MU
Accession Numbers

Genbank: NM_013487; MGI: 88331
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 44981786-44987339 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 44985693 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 122 (V122I)
Ref Sequence ENSEMBL: ENSMUSP00000034602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034602] [ENSMUST00000214715]
AlphaFold P04235
Predicted Effect probably damaging
Transcript: ENSMUST00000034602
AA Change: V122I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034602
Gene: ENSMUSG00000032094
AA Change: V122I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Ig_4 30 103 5.9e-23 PFAM
transmembrane domain 105 127 N/A INTRINSIC
ITAM 146 166 2.41e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214715
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the T-cell receptor/CD3 complex (TCR/CD3 complex) and is involved in T-cell development and signal transduction. The encoded membrane protein represents the delta subunit of the CD3 complex, and along with four other CD3 subunits, binds either TCR alpha/beta or TCR gamma/delta to form the TCR/CD3 complex on the surface of T-cells. Defects in this gene are a cause of severe combined immunodeficiency autosomal recessive T-cell-negative/B-cell-positive/NK-cell-positive (SCIDBNK). Two transcript variants encoding different isoforms have been found for this gene. Other variants may also exist, but the full-length natures of their transcripts has yet to be defined. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired early thymic development, small numbers of peripheral TCR-alpha/beta+ T cells, and failure of T lymphocyte transition from double-positive to single-positive developmental stages. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(5)
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Cd3d
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Cd3d UTSW 9 44984997 missense probably damaging 1.00
R1992:Cd3d UTSW 9 44985001 nonsense probably null
R4989:Cd3d UTSW 9 44984998 missense probably damaging 1.00
R5133:Cd3d UTSW 9 44984998 missense probably damaging 1.00
R5134:Cd3d UTSW 9 44984998 missense probably damaging 1.00
R6362:Cd3d UTSW 9 44986291 missense probably damaging 1.00
R6857:Cd3d UTSW 9 44985604 missense probably damaging 1.00
R6923:Cd3d UTSW 9 44985859 intron probably benign
R7711:Cd3d UTSW 9 44986336 missense probably benign 0.00
R8163:Cd3d UTSW 9 44985654 missense probably benign
R9071:Cd3d UTSW 9 44985042 missense probably benign
Z1176:Cd3d UTSW 9 44985628 missense probably damaging 1.00
Predicted Primers
Posted On 2019-05-13