Incidental Mutation 'R7040:Eif4enif1'
ID 547009
Institutional Source Beutler Lab
Gene Symbol Eif4enif1
Ensembl Gene ENSMUSG00000020454
Gene Name eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms D11Ertd166e, 2610509L04Rik, Clast4, A930019J01Rik
MMRRC Submission 045013-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.519) question?
Stock # R7040 (G1)
Quality Score 103.008
Status Not validated
Chromosome 11
Chromosomal Location 3152392-3194588 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 3184040 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 521 (V521G)
Ref Sequence ENSEMBL: ENSMUSP00000136768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020734] [ENSMUST00000110048] [ENSMUST00000110049] [ENSMUST00000120721] [ENSMUST00000135223] [ENSMUST00000179770]
AlphaFold Q9EST3
Predicted Effect probably benign
Transcript: ENSMUST00000020734
SMART Domains Protein: ENSMUSP00000020734
Gene: ENSMUSG00000020454

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110048
SMART Domains Protein: ENSMUSP00000105675
Gene: ENSMUSG00000020454

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 688 1.2e-189 PFAM
low complexity region 835 851 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110049
AA Change: V521G

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105676
Gene: ENSMUSG00000020454
AA Change: V521G

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 712 2.7e-184 PFAM
low complexity region 859 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120721
AA Change: V346G

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112550
Gene: ENSMUSG00000020454
AA Change: V346G

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 99 3.6e-29 PFAM
Pfam:EIF4E-T 98 327 5.1e-41 PFAM
Pfam:EIF4E-T 282 537 7.7e-30 PFAM
low complexity region 684 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135223
AA Change: V120G

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122912
Gene: ENSMUSG00000020454
AA Change: V120G

DomainStartEndE-ValueType
Pfam:EIF4E-T 1 239 1.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159304
SMART Domains Protein: ENSMUSP00000125536
Gene: ENSMUSG00000020457

DomainStartEndE-ValueType
Pfam:TGS 13 58 5.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179770
AA Change: V521G

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136768
Gene: ENSMUSG00000020454
AA Change: V521G

DomainStartEndE-ValueType
Pfam:EIF4E-T 29 710 4.3e-160 PFAM
low complexity region 859 875 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nucleocytoplasmic shuttle protein for the translation initiation factor eIF4E. This shuttle protein interacts with the importin alpha-beta complex to mediate nuclear import of eIF4E. It is predominantly cytoplasmic; its own nuclear import is regulated by a nuclear localization signal and nuclear export signals. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 127,835,897 (GRCm39) L232P possibly damaging Het
Acaa1a T C 9: 119,178,104 (GRCm39) V312A probably damaging Het
Bmp2 A G 2: 133,403,604 (GRCm39) D385G probably damaging Het
C1qtnf9 T C 14: 61,017,241 (GRCm39) V257A probably damaging Het
Cd3d G A 9: 44,896,991 (GRCm39) V122I probably damaging Het
Cdc37 T C 9: 21,053,519 (GRCm39) E199G probably damaging Het
Crb2 T A 2: 37,677,696 (GRCm39) D326E probably benign Het
Cyp2c29 A C 19: 39,318,781 (GRCm39) K420N possibly damaging Het
Cyp2g1 A C 7: 26,520,184 (GRCm39) D472A probably damaging Het
Dab2 A C 15: 6,451,732 (GRCm39) H116P probably damaging Het
Dnah7b G C 1: 46,275,969 (GRCm39) E2619Q probably benign Het
Dsg4 A T 18: 20,584,909 (GRCm39) M208L probably benign Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fpr-rs6 A G 17: 20,403,196 (GRCm39) M55T probably damaging Het
Grhpr A G 4: 44,985,362 (GRCm39) S101G probably damaging Het
Kif15 T A 9: 122,840,679 (GRCm39) D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
Lama4 A G 10: 38,936,158 (GRCm39) Q611R possibly damaging Het
Lrrc47 T A 4: 154,104,909 (GRCm39) *123R probably null Het
Map4k3 A C 17: 80,988,344 (GRCm39) V36G probably damaging Het
Mme T A 3: 63,276,344 (GRCm39) I707N probably damaging Het
Muc2 A G 7: 141,305,194 (GRCm39) E166G unknown Het
Mucl1 T A 15: 103,783,844 (GRCm39) T108S possibly damaging Het
Myo1h A T 5: 114,497,805 (GRCm39) D53V possibly damaging Het
Naa15 T A 3: 51,380,205 (GRCm39) L811Q possibly damaging Het
Nalcn T C 14: 123,525,267 (GRCm39) T1487A probably benign Het
Nme8 A T 13: 19,878,498 (GRCm39) L87H probably damaging Het
Nr2e1 A G 10: 42,444,374 (GRCm39) V245A probably damaging Het
Nt5c2 A T 19: 46,881,974 (GRCm39) F291Y possibly damaging Het
Ooep T C 9: 78,285,683 (GRCm39) N43S possibly damaging Het
Or10ak13 T C 4: 118,639,183 (GRCm39) M200V probably benign Het
Or4e1 T C 14: 52,700,932 (GRCm39) D178G possibly damaging Het
Or52i2 A T 7: 102,319,937 (GRCm39) Q270L probably benign Het
Or52n2c A T 7: 104,574,717 (GRCm39) C85S probably benign Het
Ovch2 A T 7: 107,395,772 (GRCm39) I82N probably damaging Het
Palb2 A T 7: 121,713,622 (GRCm39) M524K possibly damaging Het
Patj T C 4: 98,329,317 (GRCm39) S524P probably benign Het
Patl1 T A 19: 11,907,318 (GRCm39) Y401N possibly damaging Het
Pcdhb20 A T 18: 37,637,770 (GRCm39) T99S probably benign Het
Plcb4 G A 2: 135,774,182 (GRCm39) A155T probably benign Het
Rpap3 A G 15: 97,576,993 (GRCm39) V585A possibly damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Spen T A 4: 141,221,693 (GRCm39) T302S unknown Het
Tenm4 G A 7: 96,202,703 (GRCm39) R106H probably benign Het
Ube2o T C 11: 116,432,686 (GRCm39) E760G probably benign Het
Uimc1 T A 13: 55,223,267 (GRCm39) probably null Het
Usp16 C T 16: 87,277,817 (GRCm39) A689V probably damaging Het
Vmn2r60 G A 7: 41,791,666 (GRCm39) A530T probably benign Het
Vps8 T A 16: 21,393,772 (GRCm39) M1185K probably damaging Het
Vwa8 T C 14: 79,149,645 (GRCm39) S136P probably damaging Het
Ythdc2 A G 18: 44,967,529 (GRCm39) N175S probably benign Het
Zfp160 A T 17: 21,246,794 (GRCm39) H448L probably damaging Het
Zfp90 T A 8: 107,151,641 (GRCm39) C451* probably null Het
Zfp945 A G 17: 23,071,264 (GRCm39) C212R probably damaging Het
Other mutations in Eif4enif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Eif4enif1 APN 11 3,171,143 (GRCm39) missense probably damaging 0.96
IGL02237:Eif4enif1 APN 11 3,177,876 (GRCm39) nonsense probably null
IGL02372:Eif4enif1 APN 11 3,179,986 (GRCm39) missense probably benign 0.09
PIT4283001:Eif4enif1 UTSW 11 3,184,464 (GRCm39) missense probably damaging 1.00
R0079:Eif4enif1 UTSW 11 3,192,676 (GRCm39) nonsense probably null
R1177:Eif4enif1 UTSW 11 3,179,902 (GRCm39) missense probably damaging 1.00
R1220:Eif4enif1 UTSW 11 3,189,493 (GRCm39) splice site probably benign
R1511:Eif4enif1 UTSW 11 3,186,278 (GRCm39) missense probably benign 0.00
R1675:Eif4enif1 UTSW 11 3,165,686 (GRCm39) missense probably benign 0.02
R1908:Eif4enif1 UTSW 11 3,177,455 (GRCm39) missense probably damaging 1.00
R1940:Eif4enif1 UTSW 11 3,193,279 (GRCm39) missense probably damaging 1.00
R2173:Eif4enif1 UTSW 11 3,192,367 (GRCm39) splice site probably null
R2215:Eif4enif1 UTSW 11 3,177,476 (GRCm39) missense probably damaging 1.00
R2517:Eif4enif1 UTSW 11 3,171,168 (GRCm39) missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3,192,586 (GRCm39) missense probably damaging 1.00
R2869:Eif4enif1 UTSW 11 3,192,586 (GRCm39) missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3,192,586 (GRCm39) missense probably damaging 1.00
R2870:Eif4enif1 UTSW 11 3,192,586 (GRCm39) missense probably damaging 1.00
R2871:Eif4enif1 UTSW 11 3,192,586 (GRCm39) missense probably damaging 1.00
R2871:Eif4enif1 UTSW 11 3,192,586 (GRCm39) missense probably damaging 1.00
R2873:Eif4enif1 UTSW 11 3,192,586 (GRCm39) missense probably damaging 1.00
R3147:Eif4enif1 UTSW 11 3,194,003 (GRCm39) splice site probably null
R4195:Eif4enif1 UTSW 11 3,193,186 (GRCm39) missense possibly damaging 0.89
R4196:Eif4enif1 UTSW 11 3,193,186 (GRCm39) missense possibly damaging 0.89
R4708:Eif4enif1 UTSW 11 3,170,323 (GRCm39) missense probably damaging 1.00
R4755:Eif4enif1 UTSW 11 3,194,016 (GRCm39) missense probably damaging 1.00
R5310:Eif4enif1 UTSW 11 3,192,687 (GRCm39) missense probably damaging 1.00
R5546:Eif4enif1 UTSW 11 3,193,989 (GRCm39) missense probably damaging 0.99
R5816:Eif4enif1 UTSW 11 3,192,401 (GRCm39) missense probably benign 0.13
R6018:Eif4enif1 UTSW 11 3,192,481 (GRCm39) missense probably damaging 0.97
R6036:Eif4enif1 UTSW 11 3,189,420 (GRCm39) missense probably damaging 1.00
R6036:Eif4enif1 UTSW 11 3,189,420 (GRCm39) missense probably damaging 1.00
R6267:Eif4enif1 UTSW 11 3,177,793 (GRCm39) missense probably damaging 1.00
R6514:Eif4enif1 UTSW 11 3,190,996 (GRCm39) missense probably null 0.01
R6638:Eif4enif1 UTSW 11 3,192,463 (GRCm39) missense probably damaging 0.96
R7232:Eif4enif1 UTSW 11 3,165,678 (GRCm39) missense possibly damaging 0.75
R7385:Eif4enif1 UTSW 11 3,170,269 (GRCm39) missense probably damaging 1.00
R7478:Eif4enif1 UTSW 11 3,177,709 (GRCm39) nonsense probably null
R7749:Eif4enif1 UTSW 11 3,192,608 (GRCm39) missense probably damaging 0.99
R8381:Eif4enif1 UTSW 11 3,177,470 (GRCm39) missense probably damaging 1.00
R9029:Eif4enif1 UTSW 11 3,174,716 (GRCm39) missense probably damaging 1.00
R9622:Eif4enif1 UTSW 11 3,165,714 (GRCm39) missense probably benign 0.26
R9646:Eif4enif1 UTSW 11 3,170,280 (GRCm39) missense probably damaging 1.00
R9694:Eif4enif1 UTSW 11 3,170,384 (GRCm39) missense probably damaging 0.98
R9747:Eif4enif1 UTSW 11 3,163,267 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAACGGTCAACTCCCTTGGG -3'
(R):5'- GCTCTAAGTTAGTGCTACAGATACAG -3'

Sequencing Primer
(F):5'- TGGTCTCCAAGCTATAAAGT -3'
(R):5'- TGGTAAACCAGAAACATTAAAAGCC -3'
Posted On 2019-05-13