Incidental Mutation 'R7040:Nme8'
ID 547011
Institutional Source Beutler Lab
Gene Symbol Nme8
Ensembl Gene ENSMUSG00000041138
Gene Name NME/NM23 family member 8
Synonyms Sptrx-2, 1700056P15Rik, Txndc3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 19645078-19697794 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19694328 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 87 (L87H)
Ref Sequence ENSEMBL: ENSMUSP00000089358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039340] [ENSMUST00000091763]
AlphaFold Q715T0
Predicted Effect probably damaging
Transcript: ENSMUST00000039340
AA Change: L87H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047052
Gene: ENSMUSG00000041138
AA Change: L87H

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 3.7e-12 PFAM
Pfam:NDK 155 283 2.3e-14 PFAM
NDK 312 452 3.8e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091763
AA Change: L87H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089358
Gene: ENSMUSG00000041138
AA Change: L87H

DomainStartEndE-ValueType
Pfam:Thioredoxin 11 112 6.9e-12 PFAM
Pfam:NDK 155 284 1.1e-13 PFAM
NDK 312 449 2.75e-25 SMART
NDK 450 586 1.45e-33 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal thioredoxin domain and three C-terminal nucleoside diphosphate kinase (NDK) domains, but the NDK domains are thought to be catalytically inactive. The sea urchin ortholog of this gene encodes a component of sperm outer dynein arms, and the protein is implicated in ciliary function. Mutations in this gene are implicated in primary ciliary dyskinesia type 6.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutant displays normal reproductive system phenotype [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Nme8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Nme8 APN 13 19688980 missense probably damaging 1.00
IGL02272:Nme8 APN 13 19658826 missense probably damaging 0.99
IGL02344:Nme8 APN 13 19674404 missense possibly damaging 0.94
IGL02395:Nme8 APN 13 19677908 missense possibly damaging 0.64
IGL02621:Nme8 APN 13 19675648 missense probably damaging 1.00
IGL02645:Nme8 APN 13 19660585 missense probably damaging 1.00
IGL02807:Nme8 APN 13 19675831 unclassified probably benign
IGL03059:Nme8 APN 13 19652244 missense possibly damaging 0.92
IGL03288:Nme8 APN 13 19696606 missense possibly damaging 0.94
IGL03323:Nme8 APN 13 19688950 missense probably benign 0.06
R0139:Nme8 UTSW 13 19677848 missense probably benign 0.19
R0616:Nme8 UTSW 13 19690859 missense probably benign 0.00
R0632:Nme8 UTSW 13 19658036 missense probably damaging 0.96
R1233:Nme8 UTSW 13 19660512 missense possibly damaging 0.71
R1288:Nme8 UTSW 13 19674449 missense possibly damaging 0.87
R1305:Nme8 UTSW 13 19696907 missense possibly damaging 0.90
R1773:Nme8 UTSW 13 19697036 start codon destroyed probably damaging 1.00
R1942:Nme8 UTSW 13 19675808 missense probably damaging 1.00
R1970:Nme8 UTSW 13 19652322 missense probably damaging 1.00
R2012:Nme8 UTSW 13 19696883 missense probably damaging 1.00
R2093:Nme8 UTSW 13 19650872 missense probably damaging 1.00
R2392:Nme8 UTSW 13 19688943 critical splice donor site probably null
R2436:Nme8 UTSW 13 19677859 missense probably damaging 1.00
R2901:Nme8 UTSW 13 19675664 missense probably benign 0.02
R2902:Nme8 UTSW 13 19675664 missense probably benign 0.02
R4665:Nme8 UTSW 13 19674435 missense probably damaging 1.00
R4751:Nme8 UTSW 13 19675638 critical splice donor site probably null
R4785:Nme8 UTSW 13 19657930 missense probably damaging 0.96
R5101:Nme8 UTSW 13 19690847 critical splice donor site probably null
R5217:Nme8 UTSW 13 19696691 missense probably damaging 1.00
R5251:Nme8 UTSW 13 19660625 missense probably benign 0.33
R5356:Nme8 UTSW 13 19652299 missense probably damaging 1.00
R5397:Nme8 UTSW 13 19694379 missense probably damaging 1.00
R5624:Nme8 UTSW 13 19677868 missense possibly damaging 0.94
R6679:Nme8 UTSW 13 19690970 splice site probably null
R7111:Nme8 UTSW 13 19675647 missense probably benign 0.06
R7185:Nme8 UTSW 13 19677883 missense probably damaging 1.00
R7670:Nme8 UTSW 13 19658829 missense probably benign 0.01
R7685:Nme8 UTSW 13 19650975 missense probably benign 0.00
R8108:Nme8 UTSW 13 19650960 missense probably benign 0.00
R8331:Nme8 UTSW 13 19658866 missense probably damaging 1.00
R8413:Nme8 UTSW 13 19674519 missense probably benign 0.01
R8808:Nme8 UTSW 13 19675808 missense probably damaging 1.00
R9227:Nme8 UTSW 13 19690214 missense probably benign
R9230:Nme8 UTSW 13 19690214 missense probably benign
R9422:Nme8 UTSW 13 19675748 missense probably benign 0.01
Z1088:Nme8 UTSW 13 19688957 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTTCGTGCTGTTAAATGCGGTC -3'
(R):5'- TCCCCAGAAAACTTGTGCATG -3'

Sequencing Primer
(F):5'- GTGTGCAATAGTTTTAACAAGCTCC -3'
(R):5'- GTGCATGCTTCTATATCGTTTGAAC -3'
Posted On 2019-05-13