Incidental Mutation 'R7040:Uimc1'
ID 547012
Institutional Source Beutler Lab
Gene Symbol Uimc1
Ensembl Gene ENSMUSG00000025878
Gene Name ubiquitin interaction motif containing 1
Synonyms D330018D10Rik, D630032M02Rik, Rxrip110, 9430016E08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 55027880-55100300 bp(-) (GRCm38)
Type of Mutation splice site (1949 bp from exon)
DNA Base Change (assembly) T to A at 55075454 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026997] [ENSMUST00000099496] [ENSMUST00000127195] [ENSMUST00000148702]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000026997
AA Change: E335V

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026997
Gene: ENSMUSG00000025878
AA Change: E335V

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
low complexity region 714 727 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099496
SMART Domains Protein: ENSMUSP00000097095
Gene: ENSMUSG00000025878

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 1.53e1 SMART
low complexity region 433 446 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127195
AA Change: E335V

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122196
Gene: ENSMUSG00000025878
AA Change: E335V

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
low complexity region 714 727 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000148702
AA Change: E335V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120935
Gene: ENSMUSG00000025878
AA Change: E335V

DomainStartEndE-ValueType
UIM 80 99 7.87e-2 SMART
UIM 105 124 6.73e1 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 388 393 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with Brca1 (breast cancer 1) in a complex to recognize and repair DNA lesions. This protein binds ubiquitinated lysine 63 of histone H2A and H2AX. This protein may also function as a repressor of transcription. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death due to B-cell lymphomas and abnormal DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Uimc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Uimc1 APN 13 55034911 missense probably benign 0.05
IGL01655:Uimc1 APN 13 55028704 missense probably benign 0.11
IGL01867:Uimc1 APN 13 55075401 missense probably benign
IGL02512:Uimc1 APN 13 55040618 missense possibly damaging 0.66
IGL02704:Uimc1 APN 13 55030959 missense probably benign 0.01
PIT4382001:Uimc1 UTSW 13 55031015 missense probably benign 0.00
PIT4486001:Uimc1 UTSW 13 55075568 missense probably damaging 0.99
R0118:Uimc1 UTSW 13 55085644 missense probably damaging 0.99
R0349:Uimc1 UTSW 13 55075991 missense probably benign 0.11
R0441:Uimc1 UTSW 13 55093219 missense probably damaging 1.00
R0634:Uimc1 UTSW 13 55060266 missense possibly damaging 0.66
R0834:Uimc1 UTSW 13 55076409 critical splice acceptor site probably null
R1175:Uimc1 UTSW 13 55028602 missense possibly damaging 0.92
R2243:Uimc1 UTSW 13 55050739 critical splice donor site probably null
R2566:Uimc1 UTSW 13 55075804 missense probably damaging 1.00
R4435:Uimc1 UTSW 13 55075823 missense probably damaging 0.96
R4622:Uimc1 UTSW 13 55077494 missense probably damaging 1.00
R4935:Uimc1 UTSW 13 55093185 missense probably damaging 0.97
R5140:Uimc1 UTSW 13 55075517 missense probably damaging 1.00
R5466:Uimc1 UTSW 13 55075848 missense probably damaging 1.00
R6395:Uimc1 UTSW 13 55040576 missense possibly damaging 0.66
R6955:Uimc1 UTSW 13 55040546 missense possibly damaging 0.86
R7106:Uimc1 UTSW 13 55050815 missense possibly damaging 0.83
R7505:Uimc1 UTSW 13 55075631 missense probably damaging 1.00
R7864:Uimc1 UTSW 13 55093267 nonsense probably null
R7872:Uimc1 UTSW 13 55069737 missense possibly damaging 0.78
R8742:Uimc1 UTSW 13 55093158 missense possibly damaging 0.92
R8969:Uimc1 UTSW 13 55085634 missense possibly damaging 0.83
R9115:Uimc1 UTSW 13 55050771 missense possibly damaging 0.92
R9228:Uimc1 UTSW 13 55075839 missense probably damaging 0.96
R9424:Uimc1 UTSW 13 55075833 missense possibly damaging 0.66
RF009:Uimc1 UTSW 13 55050785 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCACGACTGGTTGTTGGTTC -3'
(R):5'- ACAAAAGGTCTCCAGGACACTG -3'

Sequencing Primer
(F):5'- GGTTCTTCCTCCAACAAAAGTTTCTG -3'
(R):5'- ACTGTGCACTACTACTGGGG -3'
Posted On 2019-05-13