Incidental Mutation 'R7040:Vwa8'
ID 547015
Institutional Source Beutler Lab
Gene Symbol Vwa8
Ensembl Gene ENSMUSG00000058997
Gene Name von Willebrand factor A domain containing 8
Synonyms 4932416F07Rik, 1300010F03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 78849052-79202310 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78912205 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 136 (S136P)
Ref Sequence ENSEMBL: ENSMUSP00000154270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040990] [ENSMUST00000227255]
AlphaFold Q8CC88
Predicted Effect probably damaging
Transcript: ENSMUST00000040990
AA Change: S136P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048925
Gene: ENSMUSG00000058997
AA Change: S136P

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 20 33 N/A INTRINSIC
Pfam:AAA_5 104 260 6.3e-44 PFAM
AAA 438 613 4.69e-2 SMART
AAA 772 904 1.26e-1 SMART
low complexity region 1213 1221 N/A INTRINSIC
low complexity region 1565 1586 N/A INTRINSIC
VWA 1712 1901 2.71e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227255
AA Change: S136P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Vwa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Vwa8 APN 14 79038195 missense probably damaging 1.00
IGL01087:Vwa8 APN 14 78935229 missense probably benign 0.16
IGL01137:Vwa8 APN 14 79103647 missense probably damaging 1.00
IGL01359:Vwa8 APN 14 79064913 nonsense probably null
IGL01449:Vwa8 APN 14 79182988 nonsense probably null
IGL01604:Vwa8 APN 14 79180804 missense possibly damaging 0.82
IGL01636:Vwa8 APN 14 79198354 missense possibly damaging 0.68
IGL01815:Vwa8 APN 14 79198277 missense possibly damaging 0.92
IGL02024:Vwa8 APN 14 79094284 missense possibly damaging 0.91
IGL02033:Vwa8 APN 14 78984209 missense possibly damaging 0.89
IGL02154:Vwa8 APN 14 78849293 missense possibly damaging 0.53
IGL02286:Vwa8 APN 14 78947273 critical splice donor site probably null
IGL02393:Vwa8 APN 14 79182977 missense probably damaging 1.00
IGL02430:Vwa8 APN 14 78934645 critical splice donor site probably null
IGL02476:Vwa8 APN 14 78925341 missense possibly damaging 0.62
IGL02612:Vwa8 APN 14 79183112 missense probably benign 0.01
IGL02678:Vwa8 APN 14 78984200 missense probably damaging 0.99
IGL02797:Vwa8 APN 14 78925262 missense probably benign 0.29
IGL02806:Vwa8 APN 14 79157088 missense probably benign 0.35
IGL02811:Vwa8 APN 14 78994459 missense probably benign 0.21
IGL02892:Vwa8 APN 14 79103700 splice site probably benign
IGL03024:Vwa8 APN 14 78995098 missense probably benign 0.03
IGL03075:Vwa8 APN 14 78933756 missense probably damaging 0.99
IGL03090:Vwa8 APN 14 78934601 missense possibly damaging 0.92
IGL03124:Vwa8 APN 14 79058815 splice site probably benign
IGL03181:Vwa8 APN 14 79009250 missense probably benign 0.01
IGL03296:Vwa8 APN 14 79183100 missense probably damaging 0.98
IGL03376:Vwa8 APN 14 79183134 splice site probably null
R6812_Vwa8_870 UTSW 14 79197419 missense probably damaging 0.99
IGL03052:Vwa8 UTSW 14 79064921 missense probably benign 0.02
PIT4468001:Vwa8 UTSW 14 79183061 missense probably damaging 1.00
R0049:Vwa8 UTSW 14 79093739 missense probably benign 0.21
R0063:Vwa8 UTSW 14 79164216 splice site probably benign
R0063:Vwa8 UTSW 14 79164216 splice site probably benign
R0081:Vwa8 UTSW 14 79082782 missense probably benign 0.02
R0305:Vwa8 UTSW 14 79009273 missense probably damaging 1.00
R0433:Vwa8 UTSW 14 79062676 missense probably damaging 1.00
R0514:Vwa8 UTSW 14 78947189 missense probably benign
R0602:Vwa8 UTSW 14 79020620 missense probably benign 0.00
R0615:Vwa8 UTSW 14 78908150 missense probably benign
R0791:Vwa8 UTSW 14 78994576 splice site probably benign
R1028:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1037:Vwa8 UTSW 14 79086654 nonsense probably null
R1404:Vwa8 UTSW 14 79026031 missense probably damaging 1.00
R1404:Vwa8 UTSW 14 79026031 missense probably damaging 1.00
R1412:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1421:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1467:Vwa8 UTSW 14 79103694 nonsense probably null
R1467:Vwa8 UTSW 14 79103694 nonsense probably null
R1539:Vwa8 UTSW 14 79062562 missense probably benign 0.00
R1556:Vwa8 UTSW 14 79086681 missense probably benign
R1589:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1590:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1591:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1645:Vwa8 UTSW 14 79182987 missense probably damaging 1.00
R1673:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1688:Vwa8 UTSW 14 79201103 missense possibly damaging 0.72
R1764:Vwa8 UTSW 14 78908195 missense probably damaging 1.00
R1830:Vwa8 UTSW 14 79081136 missense probably benign 0.04
R1926:Vwa8 UTSW 14 79020635 missense probably benign 0.00
R1959:Vwa8 UTSW 14 78982360 missense possibly damaging 0.95
R1971:Vwa8 UTSW 14 78925254 splice site probably benign
R2078:Vwa8 UTSW 14 78908157 missense probably damaging 1.00
R2103:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R2230:Vwa8 UTSW 14 79092403 critical splice donor site probably null
R2281:Vwa8 UTSW 14 79064996 missense possibly damaging 0.91
R2313:Vwa8 UTSW 14 78912218 missense probably damaging 0.98
R2847:Vwa8 UTSW 14 78947142 missense probably benign 0.00
R2848:Vwa8 UTSW 14 78947142 missense probably benign 0.00
R2894:Vwa8 UTSW 14 79038138 missense probably damaging 1.00
R2991:Vwa8 UTSW 14 78995149 missense probably benign 0.00
R3077:Vwa8 UTSW 14 79098342 missense probably benign 0.03
R3405:Vwa8 UTSW 14 79164220 splice site probably benign
R3406:Vwa8 UTSW 14 79164220 splice site probably benign
R3708:Vwa8 UTSW 14 79062696 splice site probably benign
R3779:Vwa8 UTSW 14 79102322 splice site probably benign
R3799:Vwa8 UTSW 14 79064896 missense probably damaging 0.99
R4230:Vwa8 UTSW 14 79082852 missense probably benign 0.00
R4425:Vwa8 UTSW 14 79082806 missense probably benign 0.00
R4478:Vwa8 UTSW 14 78868801 missense probably benign 0.00
R4627:Vwa8 UTSW 14 79103697 critical splice donor site probably null
R4835:Vwa8 UTSW 14 78934613 missense probably benign 0.11
R4868:Vwa8 UTSW 14 79183082 missense probably damaging 1.00
R4988:Vwa8 UTSW 14 79198283 missense probably benign 0.05
R5137:Vwa8 UTSW 14 79064902 missense probably damaging 1.00
R5156:Vwa8 UTSW 14 78984226 missense probably benign 0.00
R5658:Vwa8 UTSW 14 78982398 critical splice donor site probably null
R5841:Vwa8 UTSW 14 78994518 missense probably benign
R6057:Vwa8 UTSW 14 79082873 missense probably benign 0.21
R6244:Vwa8 UTSW 14 79086662 missense probably benign
R6264:Vwa8 UTSW 14 79086812 missense possibly damaging 0.64
R6290:Vwa8 UTSW 14 79094332 splice site probably null
R6332:Vwa8 UTSW 14 79197464 missense probably benign
R6395:Vwa8 UTSW 14 79093744 missense probably benign 0.02
R6472:Vwa8 UTSW 14 79009170 missense possibly damaging 0.71
R6497:Vwa8 UTSW 14 79096401 missense probably benign 0.00
R6527:Vwa8 UTSW 14 78947213 missense possibly damaging 0.73
R6552:Vwa8 UTSW 14 79198222 missense possibly damaging 0.80
R6812:Vwa8 UTSW 14 79197419 missense probably damaging 0.99
R6994:Vwa8 UTSW 14 78908156 missense possibly damaging 0.90
R7357:Vwa8 UTSW 14 79038201 missense probably null 1.00
R7363:Vwa8 UTSW 14 79018707 missense probably benign 0.05
R7381:Vwa8 UTSW 14 79095685 missense probably benign 0.00
R7406:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7408:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7409:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7410:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7483:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7484:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7491:Vwa8 UTSW 14 79082814 missense probably benign 0.24
R7500:Vwa8 UTSW 14 78925246 splice site probably null
R7514:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7582:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7584:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7585:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7647:Vwa8 UTSW 14 78935229 missense probably damaging 0.99
R7685:Vwa8 UTSW 14 79098300 missense probably benign
R7703:Vwa8 UTSW 14 79026073 missense probably damaging 1.00
R7730:Vwa8 UTSW 14 78995149 missense probably benign 0.00
R7775:Vwa8 UTSW 14 79038147 missense probably benign 0.03
R7778:Vwa8 UTSW 14 79038147 missense probably benign 0.03
R7824:Vwa8 UTSW 14 79038147 missense probably benign 0.03
R7885:Vwa8 UTSW 14 79020649 missense probably benign 0.00
R7902:Vwa8 UTSW 14 79092291 missense probably benign 0.00
R8262:Vwa8 UTSW 14 78933832 critical splice donor site probably null
R8458:Vwa8 UTSW 14 79064892 missense probably damaging 1.00
R8495:Vwa8 UTSW 14 78937177 nonsense probably null
R8557:Vwa8 UTSW 14 79009209 missense probably damaging 1.00
R8841:Vwa8 UTSW 14 78947262 missense probably benign 0.04
R8906:Vwa8 UTSW 14 79092375 missense probably benign 0.00
R8947:Vwa8 UTSW 14 79201112 missense probably damaging 1.00
R9034:Vwa8 UTSW 14 79058739 missense probably damaging 1.00
R9051:Vwa8 UTSW 14 79086710 missense probably benign 0.00
R9179:Vwa8 UTSW 14 79098361 missense probably benign
R9433:Vwa8 UTSW 14 79098431 critical splice donor site probably null
R9455:Vwa8 UTSW 14 79062675 missense probably damaging 1.00
Z1088:Vwa8 UTSW 14 78982246 missense probably benign 0.38
Z1177:Vwa8 UTSW 14 79058692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGTAGGATGCAGTTCAGGAAA -3'
(R):5'- TGTCTGTCAGTGACACATGACC -3'

Sequencing Primer
(F):5'- GGCTGGCCTTGAATTCACAAAGATC -3'
(R):5'- TGTCAGTGACACATGACCACTCTC -3'
Posted On 2019-05-13