Incidental Mutation 'R7040:Nalcn'
ID 547016
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Name sodium leak channel, non-selective
Synonyms A530023G15Rik, Vgcnl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 123276634-123627144 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123287855 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1487 (T1487A)
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000000201
AA Change: T1487A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197
AA Change: T1487A

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123348789 missense probably benign 0.00
IGL00964:Nalcn APN 14 123295384 splice site probably benign
IGL01310:Nalcn APN 14 123317249 missense probably benign 0.00
IGL01578:Nalcn APN 14 123572091 missense probably benign 0.00
IGL01925:Nalcn APN 14 123291848 missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123323358 missense probably benign 0.05
IGL02096:Nalcn APN 14 123594503 missense probably benign 0.11
IGL02212:Nalcn APN 14 123515330 missense probably damaging 0.99
IGL02306:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02471:Nalcn APN 14 123323314 missense probably benign 0.02
IGL02478:Nalcn APN 14 123321305 missense probably benign 0.26
IGL02551:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02630:Nalcn APN 14 123317879 missense probably benign 0.16
IGL02632:Nalcn APN 14 123317853 missense probably benign 0.11
IGL02661:Nalcn APN 14 123592909 splice site probably benign
IGL02830:Nalcn APN 14 123293469 missense probably damaging 0.98
IGL02939:Nalcn APN 14 123298872 missense probably null 1.00
IGL03035:Nalcn APN 14 123278218 nonsense probably null
IGL03226:Nalcn APN 14 123281115 missense probably benign 0.00
IGL03242:Nalcn APN 14 123321487 missense possibly damaging 0.91
Narnia UTSW 14 123291047 missense probably benign 0.11
R0019:Nalcn UTSW 14 123507489 missense probably benign 0.18
R0144:Nalcn UTSW 14 123371536 missense probably damaging 0.96
R0144:Nalcn UTSW 14 123409839 splice site probably benign
R0359:Nalcn UTSW 14 123299168 missense probably damaging 1.00
R0383:Nalcn UTSW 14 123507559 missense probably benign 0.01
R0400:Nalcn UTSW 14 123290960 splice site probably benign
R0467:Nalcn UTSW 14 123291047 missense probably benign 0.11
R0506:Nalcn UTSW 14 123596614 missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123294343 missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123299141 splice site probably benign
R0624:Nalcn UTSW 14 123370032 missense probably benign
R0883:Nalcn UTSW 14 123464740 missense probably damaging 1.00
R1381:Nalcn UTSW 14 123314105 missense probably damaging 1.00
R1467:Nalcn UTSW 14 123464656 splice site probably benign
R1689:Nalcn UTSW 14 123285254 missense probably damaging 1.00
R1726:Nalcn UTSW 14 123308404 missense probably damaging 1.00
R1774:Nalcn UTSW 14 123278266 missense probably benign
R1854:Nalcn UTSW 14 123460412 missense probably damaging 1.00
R1869:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123283601 missense probably benign 0.00
R1899:Nalcn UTSW 14 123316126 missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123302769 missense probably benign 0.08
R2016:Nalcn UTSW 14 123594581 splice site probably null
R2034:Nalcn UTSW 14 123283603 missense probably benign 0.01
R2087:Nalcn UTSW 14 123281145 missense probably benign
R2149:Nalcn UTSW 14 123370017 missense probably benign 0.01
R2157:Nalcn UTSW 14 123409752 missense probably benign 0.32
R2166:Nalcn UTSW 14 123369951 missense probably benign 0.00
R2932:Nalcn UTSW 14 123593018 missense probably benign 0.06
R3408:Nalcn UTSW 14 123596617 missense probably null 0.98
R3778:Nalcn UTSW 14 123464716 missense probably damaging 1.00
R3807:Nalcn UTSW 14 123278187 missense probably damaging 1.00
R3835:Nalcn UTSW 14 123293422 splice site probably benign
R3937:Nalcn UTSW 14 123369945 missense probably benign 0.00
R4001:Nalcn UTSW 14 123596594 missense probably damaging 1.00
R4015:Nalcn UTSW 14 123486387 missense probably damaging 1.00
R4033:Nalcn UTSW 14 123599989 splice site probably benign
R4231:Nalcn UTSW 14 123599913 missense probably benign 0.01
R4464:Nalcn UTSW 14 123323350 missense probably benign
R4512:Nalcn UTSW 14 123295448 missense probably damaging 1.00
R4542:Nalcn UTSW 14 123321477 synonymous silent
R4557:Nalcn UTSW 14 123321235 intron probably benign
R4869:Nalcn UTSW 14 123599884 missense probably benign 0.44
R5083:Nalcn UTSW 14 123323294 splice site probably null
R5109:Nalcn UTSW 14 123278238 missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123515770 missense probably damaging 0.98
R5158:Nalcn UTSW 14 123515737 missense probably damaging 1.00
R5259:Nalcn UTSW 14 123515651 missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123515365 missense probably damaging 1.00
R5514:Nalcn UTSW 14 123283711 missense probably benign 0.14
R5523:Nalcn UTSW 14 123409743 missense probably damaging 1.00
R5551:Nalcn UTSW 14 123278286 missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5671:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5750:Nalcn UTSW 14 123572038 missense probably benign
R5765:Nalcn UTSW 14 123464726 missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123409749 missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123317843 missense probably benign 0.00
R6558:Nalcn UTSW 14 123486507 missense probably benign
R6631:Nalcn UTSW 14 123460251 missense probably benign 0.17
R6667:Nalcn UTSW 14 123321323 missense probably damaging 1.00
R6670:Nalcn UTSW 14 123464672 missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123298067 missense probably damaging 0.99
R6731:Nalcn UTSW 14 123599934 missense probably benign 0.22
R6957:Nalcn UTSW 14 123507554 missense probably damaging 0.96
R6970:Nalcn UTSW 14 123314094 missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123293465 missense probably damaging 1.00
R7018:Nalcn UTSW 14 123409821 missense probably damaging 1.00
R7089:Nalcn UTSW 14 123278349 missense probably benign 0.01
R7128:Nalcn UTSW 14 123594502 missense probably damaging 0.99
R7149:Nalcn UTSW 14 123599865 missense probably benign 0.02
R7361:Nalcn UTSW 14 123291839 missense probably benign 0.00
R7378:Nalcn UTSW 14 123302890 missense probably damaging 1.00
R7408:Nalcn UTSW 14 123291860 missense probably benign 0.00
R7470:Nalcn UTSW 14 123572044 missense probably benign 0.09
R7483:Nalcn UTSW 14 123314087 missense probably damaging 1.00
R7521:Nalcn UTSW 14 123293458 missense probably damaging 1.00
R7558:Nalcn UTSW 14 123486385 critical splice donor site probably null
R7585:Nalcn UTSW 14 123515638 missense probably damaging 1.00
R7591:Nalcn UTSW 14 123323885 missense probably benign 0.01
R7761:Nalcn UTSW 14 123294379 missense probably damaging 1.00
R7761:Nalcn UTSW 14 123294380 missense probably damaging 1.00
R7811:Nalcn UTSW 14 123298945 missense probably damaging 1.00
R7983:Nalcn UTSW 14 123592997 missense probably benign 0.17
R8089:Nalcn UTSW 14 123299960 missense probably damaging 1.00
R8110:Nalcn UTSW 14 123464701 missense probably benign 0.00
R8190:Nalcn UTSW 14 123599939 missense possibly damaging 0.69
R8273:Nalcn UTSW 14 123317024 missense probably damaging 1.00
R8407:Nalcn UTSW 14 123317271 missense probably damaging 1.00
R8497:Nalcn UTSW 14 123515359 missense probably damaging 1.00
R8544:Nalcn UTSW 14 123371523 missense probably benign 0.40
R8549:Nalcn UTSW 14 123370036 missense probably benign 0.01
R8731:Nalcn UTSW 14 123599854 missense probably benign 0.01
R8862:Nalcn UTSW 14 123409787 missense possibly damaging 0.96
R8919:Nalcn UTSW 14 123323872 missense probably benign 0.00
R9072:Nalcn UTSW 14 123295451 missense possibly damaging 0.66
R9073:Nalcn UTSW 14 123295451 missense possibly damaging 0.66
R9182:Nalcn UTSW 14 123596604 missense probably damaging 1.00
R9193:Nalcn UTSW 14 123308380 nonsense probably null
R9241:Nalcn UTSW 14 123572017 missense probably benign 0.00
R9267:Nalcn UTSW 14 123281155 missense probably benign 0.08
R9274:Nalcn UTSW 14 123515656 missense probably damaging 1.00
R9277:Nalcn UTSW 14 123281111 missense probably damaging 0.98
R9376:Nalcn UTSW 14 123278301 missense possibly damaging 0.74
X0060:Nalcn UTSW 14 123285241 missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123294445 missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123594568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGGGCTGTGGAACTAG -3'
(R):5'- TATGCTGGTGATCCCTTGC -3'

Sequencing Primer
(F):5'- GGCTGTGGAACTAGCTTTATACC -3'
(R):5'- TGGTCATCCAGAGACTGCC -3'
Posted On 2019-05-13