Incidental Mutation 'R7040:Rpap3'
ID547018
Institutional Source Beutler Lab
Gene Symbol Rpap3
Ensembl Gene ENSMUSG00000022466
Gene NameRNA polymerase II associated protein 3
Synonyms2310042P20Rik, D15Ertd682e
MMRRC Submission
Accession Numbers

Genbank: NM_028003; MGI: 1277218

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7040 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location97675097-97705825 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97679112 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 585 (V585A)
Ref Sequence ENSEMBL: ENSMUSP00000023104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023104]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023104
AA Change: V585A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023104
Gene: ENSMUSG00000022466
AA Change: V585A

DomainStartEndE-ValueType
coiled coil region 9 45 N/A INTRINSIC
low complexity region 63 78 N/A INTRINSIC
low complexity region 114 125 N/A INTRINSIC
TPR 134 167 1.12e-7 SMART
TPR 168 201 2.07e1 SMART
TPR 202 235 2.36e-6 SMART
low complexity region 252 273 N/A INTRINSIC
TPR 284 317 6.58e-5 SMART
TPR 318 351 4.45e-2 SMART
TPR 352 385 3.87e-2 SMART
Pfam:RPAP3_C 540 631 3.8e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA polymerase II-associated protein. The encoded protein may function in transcriptional regulation and may also regulate apoptosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Allele List at MGI

All alleles(10) : Targeted, other(1) Gene trapped(9)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Rpap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01835:Rpap3 APN 15 97703239 missense possibly damaging 0.85
IGL02714:Rpap3 APN 15 97696577 missense possibly damaging 0.93
IGL03409:Rpap3 APN 15 97681739 missense possibly damaging 0.46
R0095:Rpap3 UTSW 15 97680536 splice site probably benign
R0847:Rpap3 UTSW 15 97703201 critical splice donor site probably null
R1496:Rpap3 UTSW 15 97686483 missense possibly damaging 0.86
R1562:Rpap3 UTSW 15 97694217 missense possibly damaging 0.86
R1603:Rpap3 UTSW 15 97701121 missense possibly damaging 0.53
R1801:Rpap3 UTSW 15 97694209 missense possibly damaging 0.73
R2163:Rpap3 UTSW 15 97680348 missense possibly damaging 0.71
R4969:Rpap3 UTSW 15 97686526 missense probably benign
R5226:Rpap3 UTSW 15 97703223 missense possibly damaging 0.53
R6610:Rpap3 UTSW 15 97688168 missense probably benign 0.24
R6613:Rpap3 UTSW 15 97681841 critical splice acceptor site probably null
R7429:Rpap3 UTSW 15 97688150 missense possibly damaging 0.96
R7430:Rpap3 UTSW 15 97688150 missense possibly damaging 0.96
R7829:Rpap3 UTSW 15 97681708 missense probably benign 0.02
R7853:Rpap3 UTSW 15 97678418 missense possibly damaging 0.92
R8223:Rpap3 UTSW 15 97691304 missense probably benign 0.02
R8366:Rpap3 UTSW 15 97681667 missense probably benign 0.18
YA93:Rpap3 UTSW 15 97693233 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACCTTACCAGGAAGCTGATGC -3'
(R):5'- CTCACTGTCTCATCAAGTATTAGTG -3'

Sequencing Primer
(F):5'- GGTAGCTCACAACCATCTGTAATG -3'
(R):5'- GTCAAATTCAACTTTCTCTT -3'
Posted On2019-05-13