Incidental Mutation 'R7040:Mucl1'
ID 547020
Institutional Source Beutler Lab
Gene Symbol Mucl1
Ensembl Gene ENSMUSG00000060311
Gene Name mucin-like 1
Synonyms Spt2, Spt-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 103751919-103755469 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103753578 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 108 (T108S)
Ref Sequence ENSEMBL: ENSMUSP00000154525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078842] [ENSMUST00000226484]
AlphaFold A0A2I3BQB5
Predicted Effect possibly damaging
Transcript: ENSMUST00000078842
AA Change: T121S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077886
Gene: ENSMUSG00000060311
AA Change: T121S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 76 93 N/A INTRINSIC
internal_repeat_1 98 134 1.67e-5 PROSPERO
internal_repeat_1 134 170 1.67e-5 PROSPERO
low complexity region 187 195 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000078842
AA Change: T121S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226484
AA Change: T108S

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Mucl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2338:Mucl1 UTSW 15 103753698 missense possibly damaging 0.66
R2850:Mucl1 UTSW 15 103752082 missense possibly damaging 0.66
R5094:Mucl1 UTSW 15 103755403 missense possibly damaging 0.83
R5704:Mucl1 UTSW 15 103755397 missense probably benign 0.05
R7774:Mucl1 UTSW 15 103753684 missense possibly damaging 0.82
R8672:Mucl1 UTSW 15 103753797 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGCCATGGGGAACTTAAGGATTC -3'
(R):5'- GAAAACCAAGATGCTGAGTCC -3'

Sequencing Primer
(F):5'- GGAACTTAAGGATTCAAAGAGTTCC -3'
(R):5'- GCTGAGTCCTCTAATTTAGCCAAGG -3'
Posted On 2019-05-13