Incidental Mutation 'R7040:Zfp945'
ID 547025
Institutional Source Beutler Lab
Gene Symbol Zfp945
Ensembl Gene ENSMUSG00000059142
Gene Name zinc finger protein 945
Synonyms A630033E08Rik, C730040L01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 22846697-22867134 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22852290 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 212 (C212R)
Ref Sequence ENSEMBL: ENSMUSP00000086074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088696] [ENSMUST00000150092] [ENSMUST00000160457]
AlphaFold F6WAU7
Predicted Effect probably damaging
Transcript: ENSMUST00000088696
AA Change: C212R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000086074
Gene: ENSMUSG00000059142
AA Change: C212R

DomainStartEndE-ValueType
KRAB 13 68 9.12e-18 SMART
ZnF_C2H2 210 232 1.45e-2 SMART
ZnF_C2H2 238 260 1.03e-2 SMART
ZnF_C2H2 266 288 1.76e-1 SMART
ZnF_C2H2 322 344 7.37e-4 SMART
ZnF_C2H2 350 372 1.5e-4 SMART
ZnF_C2H2 378 400 5.14e-3 SMART
ZnF_C2H2 406 428 9.73e-4 SMART
ZnF_C2H2 434 456 2.99e-4 SMART
ZnF_C2H2 462 484 4.54e-4 SMART
ZnF_C2H2 490 512 2.4e-3 SMART
ZnF_C2H2 518 540 1.38e-3 SMART
ZnF_C2H2 546 568 1.13e-4 SMART
ZnF_C2H2 574 596 5.59e-4 SMART
ZnF_C2H2 602 624 9.31e1 SMART
ZnF_C2H2 630 652 7.9e-4 SMART
ZnF_C2H2 658 680 3.69e-4 SMART
ZnF_C2H2 686 708 3.16e-3 SMART
ZnF_C2H2 714 736 2.95e-3 SMART
ZnF_C2H2 742 764 1.98e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150092
SMART Domains Protein: ENSMUSP00000117978
Gene: ENSMUSG00000059142

DomainStartEndE-ValueType
KRAB 34 89 9.12e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160457
AA Change: C233R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124123
Gene: ENSMUSG00000059142
AA Change: C233R

DomainStartEndE-ValueType
KRAB 34 89 9.12e-18 SMART
ZnF_C2H2 231 253 1.45e-2 SMART
ZnF_C2H2 259 281 1.03e-2 SMART
ZnF_C2H2 287 309 1.76e-1 SMART
ZnF_C2H2 343 365 7.37e-4 SMART
ZnF_C2H2 371 393 1.5e-4 SMART
ZnF_C2H2 399 421 5.14e-3 SMART
ZnF_C2H2 427 449 9.73e-4 SMART
ZnF_C2H2 455 477 2.99e-4 SMART
ZnF_C2H2 483 505 4.54e-4 SMART
ZnF_C2H2 511 533 2.4e-3 SMART
ZnF_C2H2 539 561 1.38e-3 SMART
ZnF_C2H2 567 589 1.13e-4 SMART
ZnF_C2H2 595 617 5.59e-4 SMART
ZnF_C2H2 623 645 9.31e1 SMART
ZnF_C2H2 651 673 7.9e-4 SMART
ZnF_C2H2 679 701 3.69e-4 SMART
ZnF_C2H2 707 729 3.16e-3 SMART
ZnF_C2H2 735 757 2.95e-3 SMART
ZnF_C2H2 763 785 1.98e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Other mutations in Zfp945
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Zfp945 APN 17 22851957 unclassified probably benign
IGL01077:Zfp945 APN 17 22852385 missense probably damaging 0.99
IGL02706:Zfp945 APN 17 22857282 missense probably damaging 1.00
IGL03408:Zfp945 APN 17 22852537 nonsense probably null
Small-scale UTSW 17 22850981 missense probably damaging 1.00
R0427:Zfp945 UTSW 17 22865252 missense probably benign 0.10
R0718:Zfp945 UTSW 17 22851030 missense probably damaging 1.00
R1305:Zfp945 UTSW 17 22852386 missense probably damaging 0.97
R1801:Zfp945 UTSW 17 22851762 missense probably damaging 0.97
R1837:Zfp945 UTSW 17 22851273 missense probably damaging 1.00
R2001:Zfp945 UTSW 17 22857249 critical splice donor site probably null
R4193:Zfp945 UTSW 17 22851170 unclassified probably benign
R4247:Zfp945 UTSW 17 22850609 missense probably damaging 0.98
R5026:Zfp945 UTSW 17 22850885 missense probably damaging 1.00
R5918:Zfp945 UTSW 17 22850981 missense probably damaging 1.00
R6076:Zfp945 UTSW 17 22851458 missense probably damaging 1.00
R6664:Zfp945 UTSW 17 22852365 missense probably damaging 0.99
R6997:Zfp945 UTSW 17 22852569 nonsense probably null
R7479:Zfp945 UTSW 17 22851366 missense possibly damaging 0.93
R7566:Zfp945 UTSW 17 22851753 missense possibly damaging 0.71
R7948:Zfp945 UTSW 17 22852122 missense unknown
R8383:Zfp945 UTSW 17 22851824 missense probably benign 0.05
X0063:Zfp945 UTSW 17 22852228 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGGTAATGGCATTCACGGTAGG -3'
(R):5'- TGTCACAATCAAACAGTGTACCTAG -3'

Sequencing Primer
(F):5'- GTTTTCTAAGACCTGAGCAGCAG -3'
(R):5'- GAATGAAATCACACAAGTGC -3'
Posted On 2019-05-13