Mutagenetix > Incidental Mutations

Incidental Mutation 'R7040:Dsg4'

547027

Institutional Source

Beutler Lab

Gene Symbol

Dsg4

Ensembl Gene

ENSMUSG00000001804

Gene Name

desmoglein 4

Synonyms

lah, CDHF13

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.672) question?

Stock #

R7040 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20436175-20471821 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20451852 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 208 (M208L)

Ref Sequence

ENSEMBL: ENSMUSP00000019426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019426]

AlphaFold

Q7TMD7

Predicted Effect

probably benign
Transcript: ENSMUST00000019426
AA Change: M208L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: M208L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CA	70	155	1.54e-11	SMART
CA	179	267	4.27e-19	SMART
CA	290	384	5.48e-8	SMART
CA	411	495	9.4e-7	SMART
transmembrane domain	634	656	N/A	INTRINSIC
low complexity region	724	736	N/A	INTRINSIC
Pfam:Cadherin_C	749	849	3.1e-8	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130023H24Rik	A	G	7: 128,236,725	L232P	possibly damaging	Het
Acaa1a	T	C	9: 119,349,038	V312A	probably damaging	Het
Bmp2	A	G	2: 133,561,684	D385G	probably damaging	Het
C1qtnf9	T	C	14: 60,779,792	V257A	probably damaging	Het
Cd3d	G	A	9: 44,985,693	V122I	probably damaging	Het
Cdc37	T	C	9: 21,142,223	E199G	probably damaging	Het
Crb2	T	A	2: 37,787,684	D326E	probably benign	Het
Cyp2c29	A	C	19: 39,330,337	K420N	possibly damaging	Het
Cyp2g1	A	C	7: 26,820,759	D472A	probably damaging	Het
Dab2	A	C	15: 6,422,251	H116P	probably damaging	Het
Dnah7b	G	C	1: 46,236,809	E2619Q	probably benign	Het
Eif4enif1	T	G	11: 3,234,040	V521G	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fpr-rs6	A	G	17: 20,182,934	M55T	probably damaging	Het
Grhpr	A	G	4: 44,985,362	S101G	probably damaging	Het
Kif15	T	A	9: 123,011,614	D33E	possibly damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lama4	A	G	10: 39,060,162	Q611R	possibly damaging	Het
Lrrc47	T	A	4: 154,020,452	*123R	probably null	Het
Map4k3	A	C	17: 80,680,915	V36G	probably damaging	Het
Mme	T	A	3: 63,368,923	I707N	probably damaging	Het
Muc2	A	G	7: 141,751,457	E166G	unknown	Het
Mucl1	T	A	15: 103,753,578	T108S	possibly damaging	Het
Myo1h	A	T	5: 114,359,744	D53V	possibly damaging	Het
Naa15	T	A	3: 51,472,784	L811Q	possibly damaging	Het
Nalcn	T	C	14: 123,287,855	T1487A	probably benign	Het
Nme8	A	T	13: 19,694,328	L87H	probably damaging	Het
Nr2e1	A	G	10: 42,568,378	V245A	probably damaging	Het
Nt5c2	A	T	19: 46,893,535	F291Y	possibly damaging	Het
Olfr1337	T	C	4: 118,781,986	M200V	probably benign	Het
Olfr1508	T	C	14: 52,463,475	D178G	possibly damaging	Het
Olfr556	A	T	7: 102,670,730	Q270L	probably benign	Het
Olfr668	A	T	7: 104,925,510	C85S	probably benign	Het
Ooep	T	C	9: 78,378,401	N43S	possibly damaging	Het
Ovch2	A	T	7: 107,796,565	I82N	probably damaging	Het
Palb2	A	T	7: 122,114,399	M524K	possibly damaging	Het
Patj	T	C	4: 98,441,080	S524P	probably benign	Het
Patl1	T	A	19: 11,929,954	Y401N	possibly damaging	Het
Pcdhb20	A	T	18: 37,504,717	T99S	probably benign	Het
Plcb4	G	A	2: 135,932,262	A155T	probably benign	Het
Rpap3	A	G	15: 97,679,112	V585A	possibly damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spen	T	A	4: 141,494,382	T302S	unknown	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Ube2o	T	C	11: 116,541,860	E760G	probably benign	Het
Uimc1	T	A	13: 55,075,454		probably null	Het
Usp16	C	T	16: 87,480,929	A689V	probably damaging	Het
Vmn2r60	G	A	7: 42,142,242	A530T	probably benign	Het
Vps8	T	A	16: 21,575,022	M1185K	probably damaging	Het
Vwa8	T	C	14: 78,912,205	S136P	probably damaging	Het
Ythdc2	A	G	18: 44,834,462	N175S	probably benign	Het
Zfp160	A	T	17: 21,026,532	H448L	probably damaging	Het
Zfp90	T	A	8: 106,425,009	C451*	probably null	Het
Zfp945	A	G	17: 22,852,290	C212R	probably damaging	Het

Other mutations in Dsg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Dsg4	APN	18	20461326	missense	probably benign	0.22
IGL01723:Dsg4	APN	18	20466510	missense	probably damaging	1.00
IGL02249:Dsg4	APN	18	20461304	missense	possibly damaging	0.69
IGL02445:Dsg4	APN	18	20446250	splice site	probably benign
IGL02553:Dsg4	APN	18	20462520	missense	probably benign
IGL02578:Dsg4	APN	18	20471193	missense	possibly damaging	0.94
IGL02634:Dsg4	APN	18	20458580	missense	probably benign	0.01
IGL02677:Dsg4	APN	18	20464876	missense	possibly damaging	0.62
IGL02741:Dsg4	APN	18	20471496	missense	probably benign
IGL02747:Dsg4	APN	18	20446938	missense	probably damaging	0.97
IGL03342:Dsg4	APN	18	20451823	missense	probably damaging	1.00
burrito	UTSW	18	20451862	missense	possibly damaging	0.81
R0043:Dsg4	UTSW	18	20452972	missense	probably damaging	1.00
R0375:Dsg4	UTSW	18	20470879	missense	probably damaging	1.00
R0537:Dsg4	UTSW	18	20458571	missense	probably damaging	1.00
R0619:Dsg4	UTSW	18	20461359	missense	probably benign	0.00
R0622:Dsg4	UTSW	18	20449788	missense	possibly damaging	0.51
R0765:Dsg4	UTSW	18	20454646	splice site	probably benign
R0786:Dsg4	UTSW	18	20449372	critical splice donor site	probably null
R1114:Dsg4	UTSW	18	20466483	missense	possibly damaging	0.62
R1249:Dsg4	UTSW	18	20446872	nonsense	probably null
R1372:Dsg4	UTSW	18	20449676	splice site	probably null
R1382:Dsg4	UTSW	18	20465124	missense	probably benign	0.00
R1392:Dsg4	UTSW	18	20446247	splice site	probably benign
R1442:Dsg4	UTSW	18	20462660	missense	possibly damaging	0.76
R1503:Dsg4	UTSW	18	20449679	missense	probably damaging	1.00
R1704:Dsg4	UTSW	18	20471589	missense	probably damaging	1.00
R1716:Dsg4	UTSW	18	20462461	nonsense	probably null
R1765:Dsg4	UTSW	18	20456831	missense	probably benign	0.01
R1817:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R1982:Dsg4	UTSW	18	20471212	missense	probably damaging	1.00
R2025:Dsg4	UTSW	18	20466636	nonsense	probably null
R2097:Dsg4	UTSW	18	20471044	missense	probably damaging	1.00
R2198:Dsg4	UTSW	18	20461442	missense	probably benign
R3551:Dsg4	UTSW	18	20451756	missense	probably damaging	1.00
R3742:Dsg4	UTSW	18	20471001	missense	probably damaging	1.00
R3853:Dsg4	UTSW	18	20449234	missense	probably benign
R3955:Dsg4	UTSW	18	20449375	splice site	probably null
R4006:Dsg4	UTSW	18	20470965	missense	probably damaging	0.97
R4012:Dsg4	UTSW	18	20451862	missense	possibly damaging	0.81
R4171:Dsg4	UTSW	18	20458579	nonsense	probably null
R4254:Dsg4	UTSW	18	20471538	missense	probably benign	0.07
R4504:Dsg4	UTSW	18	20461436	missense	probably benign	0.00
R4559:Dsg4	UTSW	18	20470921	missense	probably damaging	1.00
R4607:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R4612:Dsg4	UTSW	18	20462413	missense	probably benign	0.10
R4683:Dsg4	UTSW	18	20461409	missense	probably benign
R4700:Dsg4	UTSW	18	20456908	missense	possibly damaging	0.91
R4749:Dsg4	UTSW	18	20446831	missense	possibly damaging	0.88
R4775:Dsg4	UTSW	18	20471127	missense	possibly damaging	0.48
R4809:Dsg4	UTSW	18	20466621	missense	possibly damaging	0.82
R5276:Dsg4	UTSW	18	20446839	missense	probably benign	0.21
R5426:Dsg4	UTSW	18	20458484	missense	probably damaging	1.00
R5767:Dsg4	UTSW	18	20462492	nonsense	probably null
R5982:Dsg4	UTSW	18	20465169	missense	possibly damaging	0.76
R6280:Dsg4	UTSW	18	20466667	missense	probably damaging	1.00
R6305:Dsg4	UTSW	18	20449790	missense	probably damaging	1.00
R6489:Dsg4	UTSW	18	20471363	missense	possibly damaging	0.93
R7013:Dsg4	UTSW	18	20458521	missense	possibly damaging	0.58
R7196:Dsg4	UTSW	18	20466480	missense	probably damaging	1.00
R7432:Dsg4	UTSW	18	20446266	nonsense	probably null
R7438:Dsg4	UTSW	18	20466628	missense	probably damaging	0.96
R7490:Dsg4	UTSW	18	20451936	splice site	probably null
R7612:Dsg4	UTSW	18	20470990	missense	probably damaging	1.00
R7639:Dsg4	UTSW	18	20449712	missense	probably damaging	1.00
R7905:Dsg4	UTSW	18	20454669	missense	probably damaging	1.00
R8251:Dsg4	UTSW	18	20471164	missense	probably damaging	1.00
R8326:Dsg4	UTSW	18	20449731	missense	probably benign	0.31
R8554:Dsg4	UTSW	18	20453043	missense	probably damaging	1.00
R8911:Dsg4	UTSW	18	20451872	nonsense	probably null
R9059:Dsg4	UTSW	18	20471125	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CGTACTCTCAAGGAAGTCGGG -3'
(R):5'- GGTGCATAAAACGAAATCTGTATCAC -3'

Sequencing Primer
(F):5'- TACTCTCAAGGAAGTCGGGAAAATTC -3'
(R):5'- TAAAACGAAATCTGTATCACTGACC -3'

Posted On

2019-05-13