Mutagenetix > Incidental Mutations

Incidental Mutation 'R7040:Ythdc2'

547029

Institutional Source

Beutler Lab

Gene Symbol

Ythdc2

Ensembl Gene

ENSMUSG00000034653

Gene Name

YTH domain containing 2

Synonyms

3010002F02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7040 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

44827746-44889724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44834462 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 175 (N175S)

Ref Sequence

ENSEMBL: ENSMUSP00000048340 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037763]

AlphaFold

B2RR83

Predicted Effect

probably benign
Transcript: ENSMUST00000037763
AA Change: N175S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000048340
Gene: ENSMUSG00000034653
AA Change: N175S

Domain	Start	End	E-Value	Type
low complexity region	2	50	N/A	INTRINSIC
Pfam:R3H	59	119	1.7e-15	PFAM
DEXDc	206	393	4.95e-26	SMART
low complexity region	413	428	N/A	INTRINSIC
ANK	521	550	2.79e1	SMART
ANK	554	583	1.5e2	SMART
HELICc	648	759	5.31e-17	SMART
HA2	823	916	2.58e-22	SMART
Pfam:OB_NTP_bind	953	1082	1.3e-18	PFAM
low complexity region	1263	1299	N/A	INTRINSIC
Pfam:YTH	1303	1434	7.2e-50	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein binds to N6-methyladenosine, a common modified RNA nucleotide that is enriched in the stop codons and 3' UTRs of eukaryotic messenger RNAs. Binding of proteins to this modified nucleotide may regulate mRNA translation and stability. This gene may be associated with susceptibility to pancreatic cancer in human patients, and knockdown of this gene resulted in reduced proliferation in a human liver cancer cell line. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility with arrested meiosis and small gonads. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130023H24Rik	A	G	7: 128,236,725	L232P	possibly damaging	Het
Acaa1a	T	C	9: 119,349,038	V312A	probably damaging	Het
Bmp2	A	G	2: 133,561,684	D385G	probably damaging	Het
C1qtnf9	T	C	14: 60,779,792	V257A	probably damaging	Het
Cd3d	G	A	9: 44,985,693	V122I	probably damaging	Het
Cdc37	T	C	9: 21,142,223	E199G	probably damaging	Het
Crb2	T	A	2: 37,787,684	D326E	probably benign	Het
Cyp2c29	A	C	19: 39,330,337	K420N	possibly damaging	Het
Cyp2g1	A	C	7: 26,820,759	D472A	probably damaging	Het
Dab2	A	C	15: 6,422,251	H116P	probably damaging	Het
Dnah7b	G	C	1: 46,236,809	E2619Q	probably benign	Het
Dsg4	A	T	18: 20,451,852	M208L	probably benign	Het
Eif4enif1	T	G	11: 3,234,040	V521G	probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fpr-rs6	A	G	17: 20,182,934	M55T	probably damaging	Het
Grhpr	A	G	4: 44,985,362	S101G	probably damaging	Het
Kif15	T	A	9: 123,011,614	D33E	possibly damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
Lama4	A	G	10: 39,060,162	Q611R	possibly damaging	Het
Lrrc47	T	A	4: 154,020,452	*123R	probably null	Het
Map4k3	A	C	17: 80,680,915	V36G	probably damaging	Het
Mme	T	A	3: 63,368,923	I707N	probably damaging	Het
Muc2	A	G	7: 141,751,457	E166G	unknown	Het
Mucl1	T	A	15: 103,753,578	T108S	possibly damaging	Het
Myo1h	A	T	5: 114,359,744	D53V	possibly damaging	Het
Naa15	T	A	3: 51,472,784	L811Q	possibly damaging	Het
Nalcn	T	C	14: 123,287,855	T1487A	probably benign	Het
Nme8	A	T	13: 19,694,328	L87H	probably damaging	Het
Nr2e1	A	G	10: 42,568,378	V245A	probably damaging	Het
Nt5c2	A	T	19: 46,893,535	F291Y	possibly damaging	Het
Olfr1337	T	C	4: 118,781,986	M200V	probably benign	Het
Olfr1508	T	C	14: 52,463,475	D178G	possibly damaging	Het
Olfr556	A	T	7: 102,670,730	Q270L	probably benign	Het
Olfr668	A	T	7: 104,925,510	C85S	probably benign	Het
Ooep	T	C	9: 78,378,401	N43S	possibly damaging	Het
Ovch2	A	T	7: 107,796,565	I82N	probably damaging	Het
Palb2	A	T	7: 122,114,399	M524K	possibly damaging	Het
Patj	T	C	4: 98,441,080	S524P	probably benign	Het
Patl1	T	A	19: 11,929,954	Y401N	possibly damaging	Het
Pcdhb20	A	T	18: 37,504,717	T99S	probably benign	Het
Plcb4	G	A	2: 135,932,262	A155T	probably benign	Het
Rpap3	A	G	15: 97,679,112	V585A	possibly damaging	Het
Sorbs1	G	C	19: 40,376,800	R180G	probably benign	Het
Spen	T	A	4: 141,494,382	T302S	unknown	Het
Tenm4	G	A	7: 96,553,496	R106H	probably benign	Het
Ube2o	T	C	11: 116,541,860	E760G	probably benign	Het
Uimc1	T	A	13: 55,075,454		probably null	Het
Usp16	C	T	16: 87,480,929	A689V	probably damaging	Het
Vmn2r60	G	A	7: 42,142,242	A530T	probably benign	Het
Vps8	T	A	16: 21,575,022	M1185K	probably damaging	Het
Vwa8	T	C	14: 78,912,205	S136P	probably damaging	Het
Zfp160	A	T	17: 21,026,532	H448L	probably damaging	Het
Zfp90	T	A	8: 106,425,009	C451*	probably null	Het
Zfp945	A	G	17: 22,852,290	C212R	probably damaging	Het

Other mutations in Ythdc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ythdc2	APN	18	44859973	missense	probably benign
IGL00341:Ythdc2	APN	18	44850397	missense	probably benign	0.00
IGL00502:Ythdc2	APN	18	44847812	missense	probably damaging	0.99
IGL00585:Ythdc2	APN	18	44864361	missense	probably damaging	1.00
IGL01081:Ythdc2	APN	18	44850659	missense	probably benign	0.19
IGL01569:Ythdc2	APN	18	44887651	missense	probably benign
IGL01577:Ythdc2	APN	18	44858282	missense	probably benign	0.00
IGL01617:Ythdc2	APN	18	44841415	missense	possibly damaging	0.53
IGL01674:Ythdc2	APN	18	44860404	missense	probably benign	0.04
IGL01736:Ythdc2	APN	18	44850668	missense	probably damaging	0.97
IGL02095:Ythdc2	APN	18	44873140	splice site	probably benign
IGL02245:Ythdc2	APN	18	44862684	missense	possibly damaging	0.74
IGL02524:Ythdc2	APN	18	44847854	missense	probably damaging	0.98
IGL02542:Ythdc2	APN	18	44840241	missense	probably damaging	1.00
IGL02622:Ythdc2	APN	18	44859934	missense	probably damaging	0.99
IGL02795:Ythdc2	APN	18	44837438	missense	possibly damaging	0.95
IGL02935:Ythdc2	APN	18	44855045	missense	probably damaging	1.00
PIT4618001:Ythdc2	UTSW	18	44834598	missense	probably benign	0.19
R0115:Ythdc2	UTSW	18	44841423	splice site	probably benign
R0329:Ythdc2	UTSW	18	44865060	splice site	probably benign
R0472:Ythdc2	UTSW	18	44864357	missense	probably benign	0.02
R0530:Ythdc2	UTSW	18	44850398	missense	probably damaging	0.99
R0547:Ythdc2	UTSW	18	44840264	missense	possibly damaging	0.92
R0563:Ythdc2	UTSW	18	44864848	splice site	probably benign
R0609:Ythdc2	UTSW	18	44864357	missense	probably benign	0.02
R1291:Ythdc2	UTSW	18	44855209	missense	probably benign	0.33
R1469:Ythdc2	UTSW	18	44864462	missense	probably benign	0.00
R1469:Ythdc2	UTSW	18	44864462	missense	probably benign	0.00
R1724:Ythdc2	UTSW	18	44828690	missense	probably benign	0.04
R1860:Ythdc2	UTSW	18	44872956	missense	possibly damaging	0.86
R2040:Ythdc2	UTSW	18	44855174	nonsense	probably null
R2308:Ythdc2	UTSW	18	44847748	missense	possibly damaging	0.95
R3711:Ythdc2	UTSW	18	44833173	missense	probably damaging	0.98
R4005:Ythdc2	UTSW	18	44833128	missense	probably benign	0.00
R4580:Ythdc2	UTSW	18	44858198	missense	possibly damaging	0.81
R4631:Ythdc2	UTSW	18	44887631	missense	probably benign	0.03
R4815:Ythdc2	UTSW	18	44885240	missense	probably benign	0.40
R4924:Ythdc2	UTSW	18	44847804	missense	probably damaging	1.00
R4982:Ythdc2	UTSW	18	44871465	missense	probably benign	0.01
R5011:Ythdc2	UTSW	18	44854742	missense	probably benign	0.38
R5141:Ythdc2	UTSW	18	44865047	missense	probably benign	0.01
R5147:Ythdc2	UTSW	18	44844292	missense	probably damaging	0.98
R5280:Ythdc2	UTSW	18	44860621	missense	probably damaging	1.00
R5388:Ythdc2	UTSW	18	44857025	missense	possibly damaging	0.65
R5928:Ythdc2	UTSW	18	44833205	missense	probably benign
R5931:Ythdc2	UTSW	18	44872956	missense	possibly damaging	0.86
R5995:Ythdc2	UTSW	18	44886253	missense	probably damaging	1.00
R6027:Ythdc2	UTSW	18	44860436	missense	probably benign	0.02
R6056:Ythdc2	UTSW	18	44840210	missense	probably damaging	0.98
R6318:Ythdc2	UTSW	18	44860377	missense	probably benign	0.04
R6399:Ythdc2	UTSW	18	44886402	missense	possibly damaging	0.93
R6586:Ythdc2	UTSW	18	44845788	missense	probably benign	0.00
R6684:Ythdc2	UTSW	18	44873069	missense	possibly damaging	0.47
R7071:Ythdc2	UTSW	18	44845788	missense	probably benign	0.00
R7105:Ythdc2	UTSW	18	44834563	missense	probably damaging	1.00
R7148:Ythdc2	UTSW	18	44833122	missense	probably benign	0.42
R7290:Ythdc2	UTSW	18	44837491	missense	possibly damaging	0.50
R7806:Ythdc2	UTSW	18	44844286	missense	possibly damaging	0.91
R7806:Ythdc2	UTSW	18	44850424	missense	probably benign	0.05
R8114:Ythdc2	UTSW	18	44877740	missense	probably benign	0.15
R8820:Ythdc2	UTSW	18	44834464	nonsense	probably null
R8840:Ythdc2	UTSW	18	44860624	missense	probably damaging	1.00
R8998:Ythdc2	UTSW	18	44864304	missense	probably benign	0.31
R9065:Ythdc2	UTSW	18	44844351	missense	probably benign	0.00
R9196:Ythdc2	UTSW	18	44855397	missense	probably damaging	0.96
R9251:Ythdc2	UTSW	18	44841375	missense	probably benign	0.00
R9331:Ythdc2	UTSW	18	44837432	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GCCTGTAAACTCACACATGC -3'
(R):5'- GAACTCTATGCCCAGTCTCC -3'

Sequencing Primer
(F):5'- CTGTAAACTCACACATGCAGGAGG -3'
(R):5'- GTTCTACATAGTAAGTGCCAGCCAG -3'

Posted On

2019-05-13