Incidental Mutation 'R7040:Patl1'
ID 547030
Institutional Source Beutler Lab
Gene Symbol Patl1
Ensembl Gene ENSMUSG00000046139
Gene Name protein associated with topoisomerase II homolog 1 (yeast)
Synonyms Pat1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock # R7040 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 11912399-11945096 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 11929954 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 401 (Y401N)
Ref Sequence ENSEMBL: ENSMUSP00000060398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061618]
AlphaFold Q3TC46
Predicted Effect possibly damaging
Transcript: ENSMUST00000061618
AA Change: Y401N

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060398
Gene: ENSMUSG00000046139
AA Change: Y401N

DomainStartEndE-ValueType
SCOP:d1sig__ 8 111 2e-3 SMART
low complexity region 211 228 N/A INTRINSIC
low complexity region 245 276 N/A INTRINSIC
low complexity region 310 339 N/A INTRINSIC
low complexity region 356 380 N/A INTRINSIC
Pfam:PAT1 465 726 1.9e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2c29 A C 19: 39,330,337 K420N possibly damaging Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Patl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Patl1 APN 19 11929887 missense probably benign
IGL01396:Patl1 APN 19 11923883 missense probably damaging 0.98
IGL02071:Patl1 APN 19 11939690 missense probably damaging 1.00
IGL02239:Patl1 APN 19 11937359 nonsense probably null
IGL02306:Patl1 APN 19 11942886 missense possibly damaging 0.47
IGL02468:Patl1 APN 19 11932210 missense probably damaging 1.00
IGL03193:Patl1 APN 19 11920840 missense possibly damaging 0.49
R0382:Patl1 UTSW 19 11925232 splice site probably null
R1015:Patl1 UTSW 19 11920373 missense probably benign 0.00
R1871:Patl1 UTSW 19 11925232 splice site probably benign
R1969:Patl1 UTSW 19 11921418 missense probably benign
R2012:Patl1 UTSW 19 11939817 missense probably damaging 1.00
R2058:Patl1 UTSW 19 11932147 missense possibly damaging 0.87
R2859:Patl1 UTSW 19 11923831 missense probably damaging 1.00
R4043:Patl1 UTSW 19 11942950 missense probably damaging 1.00
R4079:Patl1 UTSW 19 11931630 missense probably damaging 1.00
R4647:Patl1 UTSW 19 11914434 missense probably damaging 1.00
R4735:Patl1 UTSW 19 11922505 missense probably benign
R4830:Patl1 UTSW 19 11925151 missense probably benign 0.01
R5321:Patl1 UTSW 19 11921421 missense probably damaging 0.99
R5322:Patl1 UTSW 19 11920859 nonsense probably null
R5460:Patl1 UTSW 19 11935718 missense possibly damaging 0.80
R5855:Patl1 UTSW 19 11921516 missense probably damaging 0.99
R5933:Patl1 UTSW 19 11939772 missense probably benign 0.08
R6020:Patl1 UTSW 19 11937354 missense probably damaging 1.00
R6261:Patl1 UTSW 19 11920331 missense probably damaging 1.00
R6317:Patl1 UTSW 19 11920878 missense probably damaging 1.00
R7387:Patl1 UTSW 19 11933730 missense probably benign 0.01
R8754:Patl1 UTSW 19 11922534 missense probably damaging 0.97
R8936:Patl1 UTSW 19 11914361 missense probably damaging 1.00
R8984:Patl1 UTSW 19 11921396 missense probably damaging 0.98
R9088:Patl1 UTSW 19 11942925 missense possibly damaging 0.58
R9106:Patl1 UTSW 19 11931609 missense probably damaging 0.97
R9309:Patl1 UTSW 19 11935718 missense probably damaging 0.98
R9431:Patl1 UTSW 19 11921451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTGCAGTTCCGTTTTCC -3'
(R):5'- GGCAATAGCTCAATAGAAAGTCTAC -3'

Sequencing Primer
(F):5'- TTCCTTCACAAAAATCAAAGGGGG -3'
(R):5'- TCTAAGCTAGCCTGGCTA -3'
Posted On 2019-05-13