Incidental Mutation 'R7040:Cyp2c29'
ID547031
Institutional Source Beutler Lab
Gene Symbol Cyp2c29
Ensembl Gene ENSMUSG00000003053
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 29
SynonymsAh-2, Cyp2c, P450-2C, Ahh-1, AHOHase, AHOH
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7040 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location39269405-39330713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 39330337 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 420 (K420N)
Ref Sequence ENSEMBL: ENSMUSP00000135863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003137] [ENSMUST00000176624] [ENSMUST00000177087]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003137
AA Change: K459N

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003137
Gene: ENSMUSG00000003053
AA Change: K459N

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:p450 30 487 5.4e-165 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176624
AA Change: K420N

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135863
Gene: ENSMUSG00000003053
AA Change: K420N

DomainStartEndE-ValueType
Pfam:p450 12 448 2.7e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177087
SMART Domains Protein: ENSMUSP00000135839
Gene: ENSMUSG00000003053

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:p450 30 118 8.4e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A G 7: 128,236,725 L232P possibly damaging Het
Acaa1a T C 9: 119,349,038 V312A probably damaging Het
Bmp2 A G 2: 133,561,684 D385G probably damaging Het
C1qtnf9 T C 14: 60,779,792 V257A probably damaging Het
Cd3d G A 9: 44,985,693 V122I probably damaging Het
Cdc37 T C 9: 21,142,223 E199G probably damaging Het
Crb2 T A 2: 37,787,684 D326E probably benign Het
Cyp2g1 A C 7: 26,820,759 D472A probably damaging Het
Dab2 A C 15: 6,422,251 H116P probably damaging Het
Dnah7b G C 1: 46,236,809 E2619Q probably benign Het
Dsg4 A T 18: 20,451,852 M208L probably benign Het
Eif4enif1 T G 11: 3,234,040 V521G probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fpr-rs6 A G 17: 20,182,934 M55T probably damaging Het
Grhpr A G 4: 44,985,362 S101G probably damaging Het
Kif15 T A 9: 123,011,614 D33E possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Lama4 A G 10: 39,060,162 Q611R possibly damaging Het
Lrrc47 T A 4: 154,020,452 *123R probably null Het
Map4k3 A C 17: 80,680,915 V36G probably damaging Het
Mme T A 3: 63,368,923 I707N probably damaging Het
Muc2 A G 7: 141,751,457 E166G unknown Het
Mucl1 T A 15: 103,753,578 T108S possibly damaging Het
Myo1h A T 5: 114,359,744 D53V possibly damaging Het
Naa15 T A 3: 51,472,784 L811Q possibly damaging Het
Nalcn T C 14: 123,287,855 T1487A probably benign Het
Nme8 A T 13: 19,694,328 L87H probably damaging Het
Nr2e1 A G 10: 42,568,378 V245A probably damaging Het
Nt5c2 A T 19: 46,893,535 F291Y possibly damaging Het
Olfr1337 T C 4: 118,781,986 M200V probably benign Het
Olfr1508 T C 14: 52,463,475 D178G possibly damaging Het
Olfr556 A T 7: 102,670,730 Q270L probably benign Het
Olfr668 A T 7: 104,925,510 C85S probably benign Het
Ooep T C 9: 78,378,401 N43S possibly damaging Het
Ovch2 A T 7: 107,796,565 I82N probably damaging Het
Palb2 A T 7: 122,114,399 M524K possibly damaging Het
Patj T C 4: 98,441,080 S524P probably benign Het
Patl1 T A 19: 11,929,954 Y401N possibly damaging Het
Pcdhb20 A T 18: 37,504,717 T99S probably benign Het
Plcb4 G A 2: 135,932,262 A155T probably benign Het
Rpap3 A G 15: 97,679,112 V585A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spen T A 4: 141,494,382 T302S unknown Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Ube2o T C 11: 116,541,860 E760G probably benign Het
Uimc1 T A 13: 55,075,454 probably null Het
Usp16 C T 16: 87,480,929 A689V probably damaging Het
Vmn2r60 G A 7: 42,142,242 A530T probably benign Het
Vps8 T A 16: 21,575,022 M1185K probably damaging Het
Vwa8 T C 14: 78,912,205 S136P probably damaging Het
Ythdc2 A G 18: 44,834,462 N175S probably benign Het
Zfp160 A T 17: 21,026,532 H448L probably damaging Het
Zfp90 T A 8: 106,425,009 C451* probably null Het
Zfp945 A G 17: 22,852,290 C212R probably damaging Het
Other mutations in Cyp2c29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Cyp2c29 APN 19 39321699 splice site probably benign
IGL00482:Cyp2c29 APN 19 39325023 missense probably damaging 0.97
IGL00694:Cyp2c29 APN 19 39321635 missense possibly damaging 0.64
IGL00836:Cyp2c29 APN 19 39324990 missense probably damaging 0.98
IGL00858:Cyp2c29 APN 19 39307656 missense probably damaging 1.00
IGL01350:Cyp2c29 APN 19 39330327 missense probably damaging 1.00
IGL01455:Cyp2c29 APN 19 39329117 missense possibly damaging 0.89
IGL01718:Cyp2c29 APN 19 39330260 missense possibly damaging 0.48
IGL01977:Cyp2c29 APN 19 39290897 splice site probably benign
IGL01991:Cyp2c29 APN 19 39330315 missense probably damaging 1.00
IGL02097:Cyp2c29 APN 19 39307620 missense probably damaging 1.00
IGL02267:Cyp2c29 APN 19 39330422 missense probably benign 0.19
IGL02451:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02452:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02548:Cyp2c29 APN 19 39290847 missense possibly damaging 0.66
IGL02549:Cyp2c29 APN 19 39309785 missense possibly damaging 0.48
IGL02938:Cyp2c29 APN 19 39287123 missense probably damaging 0.99
IGL03252:Cyp2c29 APN 19 39287175 missense probably damaging 1.00
IGL03367:Cyp2c29 APN 19 39329215 missense probably damaging 0.97
H8562:Cyp2c29 UTSW 19 39309662 missense probably damaging 1.00
IGL03052:Cyp2c29 UTSW 19 39287218 missense possibly damaging 0.90
R0415:Cyp2c29 UTSW 19 39329095 splice site probably benign
R0504:Cyp2c29 UTSW 19 39309780 missense probably benign 0.29
R0690:Cyp2c29 UTSW 19 39309726 missense probably benign 0.00
R1531:Cyp2c29 UTSW 19 39324968 missense probably damaging 1.00
R1730:Cyp2c29 UTSW 19 39324945 missense possibly damaging 0.79
R1981:Cyp2c29 UTSW 19 39307772 splice site probably null
R2113:Cyp2c29 UTSW 19 39330264 missense probably damaging 1.00
R2220:Cyp2c29 UTSW 19 39287232 missense probably benign 0.09
R3873:Cyp2c29 UTSW 19 39329144 missense probably damaging 0.99
R4424:Cyp2c29 UTSW 19 39287176 missense probably damaging 0.98
R4451:Cyp2c29 UTSW 19 39290826 missense probably damaging 0.99
R4803:Cyp2c29 UTSW 19 39324995 missense probably benign 0.01
R5288:Cyp2c29 UTSW 19 39330372 missense probably damaging 0.96
R5474:Cyp2c29 UTSW 19 39324992 missense probably damaging 1.00
R5475:Cyp2c29 UTSW 19 39330287 missense possibly damaging 0.91
R5893:Cyp2c29 UTSW 19 39330389 missense possibly damaging 0.93
R5894:Cyp2c29 UTSW 19 39330389 missense possibly damaging 0.93
R6000:Cyp2c29 UTSW 19 39307606 critical splice acceptor site probably null
R6144:Cyp2c29 UTSW 19 39321609 missense possibly damaging 0.96
R6296:Cyp2c29 UTSW 19 39330261 missense possibly damaging 0.64
R6365:Cyp2c29 UTSW 19 39307754 missense probably damaging 1.00
R6449:Cyp2c29 UTSW 19 39290867 missense probably benign 0.05
R6464:Cyp2c29 UTSW 19 39329225 missense probably damaging 0.96
R6919:Cyp2c29 UTSW 19 39291141 missense probably benign 0.26
R6978:Cyp2c29 UTSW 19 39321663 missense probably damaging 1.00
R7038:Cyp2c29 UTSW 19 39287127 missense probably benign 0.01
R7391:Cyp2c29 UTSW 19 39307767 missense probably null 0.98
X0024:Cyp2c29 UTSW 19 39321599 missense probably benign 0.01
Z1176:Cyp2c29 UTSW 19 39324997 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTCAGCCATCCATCTAATCACCT -3'
(R):5'- AAGCCAGGATGAAAGATACCAT -3'

Sequencing Primer
(F):5'- GCCATCCATCTAATCACCTATACAC -3'
(R):5'- AGGATGAAAGATACCATATCCCTG -3'
Posted On2019-05-13